Incidental Mutation 'R6444:Miga1'
ID538064
Institutional Source Beutler Lab
Gene Symbol Miga1
Ensembl Gene ENSMUSG00000054942
Gene Namemitoguardin 1
SynonymsC030011O14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6444 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location152273849-152340407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 152283831 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 473 (V473E)
Ref Sequence ENSEMBL: ENSMUSP00000143238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068243] [ENSMUST00000073089] [ENSMUST00000199334]
Predicted Effect probably damaging
Transcript: ENSMUST00000068243
AA Change: V409E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068261
Gene: ENSMUSG00000054942
AA Change: V409E

DomainStartEndE-ValueType
Pfam:DUF2217 26 306 6.3e-74 PFAM
Pfam:DUF2217 298 507 2.8e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073089
AA Change: V473E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072836
Gene: ENSMUSG00000054942
AA Change: V473E

DomainStartEndE-ValueType
Pfam:DUF2217 27 571 4.8e-245 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199334
AA Change: V473E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143238
Gene: ENSMUSG00000054942
AA Change: V473E

DomainStartEndE-ValueType
Pfam:DUF2217 26 496 1.2e-179 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik ACAGAGCAGTGCCTACCAG ACAG 5: 138,639,569 probably benign Het
Bcas2 T A 3: 103,172,046 probably null Het
Camk1d A T 2: 5,313,145 I233N probably damaging Het
Chd2 T C 7: 73,501,037 probably null Het
Cnot2 T C 10: 116,499,355 D246G probably benign Het
Cped1 A C 6: 21,986,931 I41L probably benign Het
Dcdc2c A G 12: 28,535,476 V174A probably damaging Het
Dscam G A 16: 96,619,644 R1681C probably damaging Het
Dysf G A 6: 84,190,840 V1755M probably benign Het
Eif5b G A 1: 38,036,211 D590N probably damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galns T C 8: 122,611,338 M1V probably null Het
Galnt15 T C 14: 32,040,411 F199L probably damaging Het
Gm8229 A T 14: 44,365,471 H38L unknown Het
Magel2 T C 7: 62,379,999 Y884H unknown Het
Mrgprx1 C T 7: 48,021,814 V62I possibly damaging Het
Mybl1 G A 1: 9,685,692 P211S possibly damaging Het
Myo19 A G 11: 84,895,308 H254R probably benign Het
Myo1h A G 5: 114,314,956 T6A possibly damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr1475 A T 19: 13,479,430 M256K possibly damaging Het
Olfr44 T C 9: 39,484,318 T309A probably benign Het
Psmd12 A G 11: 107,486,454 E113G possibly damaging Het
Ptpn3 T C 4: 57,195,730 D879G possibly damaging Het
Rufy3 A G 5: 88,637,307 Q414R probably damaging Het
Slc14a2 A G 18: 78,154,102 I813T probably damaging Het
Smok2a G T 17: 13,225,613 A26S probably benign Het
Spsb3 T A 17: 24,891,576 L459Q probably damaging Het
Tacc2 T C 7: 130,623,412 V609A possibly damaging Het
Tmem185b C A 1: 119,526,635 A42E probably damaging Het
Trim56 A G 5: 137,112,616 V682A probably damaging Het
Trim75 T C 8: 64,982,836 K321E possibly damaging Het
Ttc17 A C 2: 94,303,546 M1098R possibly damaging Het
Ydjc C A 16: 17,147,681 H136Q probably damaging Het
Zfp568 A T 7: 30,017,257 H193L probably benign Het
Znhit1 A G 5: 136,982,400 V153A probably benign Het
Other mutations in Miga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Miga1 APN 3 152276690 missense probably benign 0.18
IGL01461:Miga1 APN 3 152335297 missense probably damaging 1.00
IGL02962:Miga1 APN 3 152285341 splice site probably benign
R0165:Miga1 UTSW 3 152290843 missense probably damaging 0.99
R0945:Miga1 UTSW 3 152317663 missense possibly damaging 0.85
R1527:Miga1 UTSW 3 152317663 missense possibly damaging 0.85
R1769:Miga1 UTSW 3 152287554 missense probably damaging 1.00
R1978:Miga1 UTSW 3 152335304 frame shift probably null
R3697:Miga1 UTSW 3 152322436 missense probably damaging 0.99
R4649:Miga1 UTSW 3 152279005 missense probably benign 0.28
R4660:Miga1 UTSW 3 152287518 missense probably damaging 1.00
R4679:Miga1 UTSW 3 152322475 missense probably damaging 1.00
R4815:Miga1 UTSW 3 152290806 missense probably benign 0.00
R5019:Miga1 UTSW 3 152322461 missense possibly damaging 0.86
R5488:Miga1 UTSW 3 152333446 small deletion probably benign
R6107:Miga1 UTSW 3 152335399 missense probably benign 0.03
R6227:Miga1 UTSW 3 152278949 missense probably benign 0.09
R6292:Miga1 UTSW 3 152317719 missense probably benign 0.30
R6438:Miga1 UTSW 3 152322403 missense probably damaging 1.00
R6489:Miga1 UTSW 3 152279008 missense probably damaging 0.99
R6564:Miga1 UTSW 3 152285322 missense probably damaging 1.00
R7354:Miga1 UTSW 3 152290500 missense probably damaging 1.00
R7440:Miga1 UTSW 3 152338046 critical splice acceptor site probably null
R7638:Miga1 UTSW 3 152276687 missense probably benign 0.00
R8039:Miga1 UTSW 3 152276756 missense probably benign 0.15
R8154:Miga1 UTSW 3 152320700 unclassified probably benign
R8418:Miga1 UTSW 3 152285317 missense probably damaging 1.00
R8423:Miga1 UTSW 3 152322408 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCCTTACTAGATACTGCAGG -3'
(R):5'- AGGAACCCAGAGTTGTCCTTAC -3'

Sequencing Primer
(F):5'- AGTCTTCCAGTCTCAGCT -3'
(R):5'- GAAACAGGGTTTCTCTATATAGCCC -3'
Posted On2018-10-19