Incidental Mutation 'R3702:Cluh'
ID 258576
Institutional Source Beutler Lab
Gene Symbol Cluh
Ensembl Gene ENSMUSG00000020741
Gene Name clustered mitochondria (cluA/CLU1) homolog
Synonyms 1300001I01Rik
MMRRC Submission 040695-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.212) question?
Stock # R3702 (G1)
Quality Score 221
Status Validated
Chromosome 11
Chromosomal Location 74649495-74670847 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74665356 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 878 (M878V)
Ref Sequence ENSEMBL: ENSMUSP00000113371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092915] [ENSMUST00000117818]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000092915
AA Change: M929V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090593
Gene: ENSMUSG00000020741
AA Change: M929V

DomainStartEndE-ValueType
Pfam:CLU_N 104 177 3.1e-28 PFAM
Pfam:CLU 394 614 3.4e-89 PFAM
Pfam:eIF3_p135 806 988 1.3e-58 PFAM
Pfam:TPR_10 1059 1100 2.9e-7 PFAM
low complexity region 1114 1125 N/A INTRINSIC
Pfam:TPR_12 1140 1218 1.7e-10 PFAM
low complexity region 1316 1334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117818
AA Change: M878V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113371
Gene: ENSMUSG00000020741
AA Change: M878V

DomainStartEndE-ValueType
Pfam:CLU_N 102 177 9.8e-30 PFAM
Pfam:CLU 394 615 5.3e-92 PFAM
Pfam:eIF3_p135 796 938 2.9e-38 PFAM
Pfam:TPR_10 1008 1049 9.5e-7 PFAM
low complexity region 1063 1074 N/A INTRINSIC
Pfam:TPR_12 1089 1167 1.1e-9 PFAM
low complexity region 1265 1283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155558
Meta Mutation Damage Score 0.0691 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Constitutive homozygous KO affects liver mitochondrial function and leads to neonatal lethality. Conditional homozygous KO in the adult liver affects cellular respiration under energy stress conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,015,330 N55I probably benign Het
9530053A07Rik G A 7: 28,157,778 V2184M probably damaging Het
Abca5 C T 11: 110,288,058 probably null Het
Cacna1a T G 8: 84,617,846 S1846A probably damaging Het
Cacna1i A T 15: 80,381,071 probably benign Het
Calhm3 T A 19: 47,151,748 D302V possibly damaging Het
Col24a1 C T 3: 145,337,860 H603Y probably benign Het
Commd1 T A 11: 22,974,057 L277H probably damaging Het
Cpped1 G T 16: 11,828,440 D135E probably damaging Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Elfn1 A G 5: 139,972,359 T373A probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Grik4 T C 9: 42,675,218 K114E probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Lrp1 C A 10: 127,595,103 R359L probably damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Mtmr10 T C 7: 64,337,899 L729P probably damaging Het
Myot T A 18: 44,354,095 probably null Het
Obox2 G T 7: 15,396,957 R38L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pcdha3 A G 18: 36,947,348 Q381R probably benign Het
Pip4k2b A G 11: 97,729,548 probably benign Het
Ppig T A 2: 69,733,209 S89T probably damaging Het
Prune2 A G 19: 17,178,871 D47G probably damaging Het
Sh2b2 A G 5: 136,224,233 S362P probably damaging Het
Snap91 G A 9: 86,806,520 T322I probably damaging Het
Taf3 G A 2: 9,952,561 T112I possibly damaging Het
Tcea1 T C 1: 4,894,935 V276A probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tomm40 G T 7: 19,713,673 T144K possibly damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp326 A G 5: 105,888,843 probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Other mutations in Cluh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cluh APN 11 74664064 missense probably benign 0.28
IGL00858:Cluh APN 11 74659605 missense possibly damaging 0.86
IGL01380:Cluh APN 11 74665946 missense probably benign 0.04
IGL02402:Cluh APN 11 74657171 missense probably damaging 1.00
IGL02620:Cluh APN 11 74665067 nonsense probably null
IGL02990:Cluh APN 11 74667765 splice site probably null
IGL03163:Cluh APN 11 74666068 missense probably benign 0.44
IGL03208:Cluh APN 11 74669506 splice site probably null
IGL03293:Cluh APN 11 74665752 missense probably benign 0.03
IGL03408:Cluh APN 11 74665953 missense probably benign 0.06
spent UTSW 11 74660372 missense probably damaging 1.00
FR4342:Cluh UTSW 11 74669524 small insertion probably benign
FR4342:Cluh UTSW 11 74669526 small insertion probably benign
FR4449:Cluh UTSW 11 74669532 small insertion probably benign
FR4589:Cluh UTSW 11 74669531 small insertion probably benign
FR4737:Cluh UTSW 11 74669514 small insertion probably benign
FR4737:Cluh UTSW 11 74669519 small insertion probably benign
FR4737:Cluh UTSW 11 74669524 small insertion probably benign
FR4737:Cluh UTSW 11 74669533 small insertion probably benign
FR4976:Cluh UTSW 11 74669520 small insertion probably benign
R0147:Cluh UTSW 11 74665938 missense probably damaging 1.00
R0153:Cluh UTSW 11 74657350 splice site probably benign
R0506:Cluh UTSW 11 74664894 missense probably benign 0.20
R0526:Cluh UTSW 11 74665986 missense probably benign 0.05
R0834:Cluh UTSW 11 74663805 missense probably benign 0.02
R1873:Cluh UTSW 11 74662076 missense possibly damaging 0.72
R1991:Cluh UTSW 11 74659529 nonsense probably null
R1992:Cluh UTSW 11 74660002 missense probably damaging 1.00
R2095:Cluh UTSW 11 74661724 nonsense probably null
R2101:Cluh UTSW 11 74660502 splice site probably benign
R2103:Cluh UTSW 11 74659529 nonsense probably null
R2220:Cluh UTSW 11 74667121 missense probably damaging 1.00
R3853:Cluh UTSW 11 74656453 missense probably benign 0.00
R3900:Cluh UTSW 11 74667104 missense probably benign 0.29
R4891:Cluh UTSW 11 74665059 missense possibly damaging 0.51
R4895:Cluh UTSW 11 74667405 missense probably damaging 1.00
R5056:Cluh UTSW 11 74661946 missense probably damaging 1.00
R5089:Cluh UTSW 11 74660372 missense probably damaging 1.00
R5217:Cluh UTSW 11 74659705 missense probably damaging 1.00
R5346:Cluh UTSW 11 74665218 missense probably damaging 1.00
R5382:Cluh UTSW 11 74665109 intron probably benign
R5516:Cluh UTSW 11 74660444 missense probably damaging 1.00
R5809:Cluh UTSW 11 74661700 missense probably damaging 1.00
R6146:Cluh UTSW 11 74667228 splice site probably null
R6326:Cluh UTSW 11 74666242 missense probably benign 0.10
R6541:Cluh UTSW 11 74657214 missense probably damaging 1.00
R6674:Cluh UTSW 11 74666227 missense probably damaging 1.00
R6870:Cluh UTSW 11 74665384 missense probably damaging 1.00
R6875:Cluh UTSW 11 74661918 missense probably damaging 1.00
R7086:Cluh UTSW 11 74667340 missense possibly damaging 0.46
R7225:Cluh UTSW 11 74666406 splice site probably null
R7310:Cluh UTSW 11 74669459 missense probably benign 0.10
R7317:Cluh UTSW 11 74665704 missense possibly damaging 0.90
R7674:Cluh UTSW 11 74667720 missense probably damaging 1.00
R7941:Cluh UTSW 11 74659757 missense probably benign 0.00
R9061:Cluh UTSW 11 74660366 missense possibly damaging 0.73
R9326:Cluh UTSW 11 74664076 missense probably benign 0.00
R9489:Cluh UTSW 11 74667946 missense possibly damaging 0.92
R9605:Cluh UTSW 11 74667946 missense possibly damaging 0.92
RF020:Cluh UTSW 11 74669538 small insertion probably benign
RF032:Cluh UTSW 11 74669515 small insertion probably benign
X0028:Cluh UTSW 11 74663466 missense probably benign 0.26
Z1177:Cluh UTSW 11 74667754 missense possibly damaging 0.82
Z1186:Cluh UTSW 11 74669517 small insertion probably benign
Z1186:Cluh UTSW 11 74669531 small insertion probably benign
Z1187:Cluh UTSW 11 74669514 small insertion probably benign
Z1187:Cluh UTSW 11 74669516 small insertion probably benign
Z1187:Cluh UTSW 11 74669517 small insertion probably benign
Z1187:Cluh UTSW 11 74669520 small insertion probably benign
Z1187:Cluh UTSW 11 74669521 small insertion probably benign
Z1187:Cluh UTSW 11 74669524 small insertion probably benign
Z1187:Cluh UTSW 11 74669529 small insertion probably benign
Z1188:Cluh UTSW 11 74669517 small insertion probably benign
Z1189:Cluh UTSW 11 74669514 frame shift probably null
Z1189:Cluh UTSW 11 74669517 small insertion probably benign
Z1189:Cluh UTSW 11 74669519 small insertion probably benign
Z1189:Cluh UTSW 11 74669523 small insertion probably benign
Z1189:Cluh UTSW 11 74669529 small insertion probably benign
Z1189:Cluh UTSW 11 74669530 nonsense probably null
Z1189:Cluh UTSW 11 74669531 small insertion probably benign
Z1190:Cluh UTSW 11 74669517 small insertion probably benign
Z1190:Cluh UTSW 11 74669518 small insertion probably benign
Z1190:Cluh UTSW 11 74669530 small insertion probably benign
Z1190:Cluh UTSW 11 74669532 small insertion probably benign
Z1191:Cluh UTSW 11 74669514 small insertion probably benign
Z1191:Cluh UTSW 11 74669517 small insertion probably benign
Z1191:Cluh UTSW 11 74669523 small insertion probably benign
Z1191:Cluh UTSW 11 74669526 small insertion probably benign
Z1191:Cluh UTSW 11 74669530 small insertion probably benign
Z1192:Cluh UTSW 11 74669517 small insertion probably benign
Z1192:Cluh UTSW 11 74669525 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGGGCCATCCTGACTTCAAC -3'
(R):5'- ATAACTAAGCCTGTTTGCCTGC -3'

Sequencing Primer
(F):5'- CCAAAAATTGGCTCAGGGAGTG -3'
(R):5'- GCTGTCTTCACTCTACTGCCCTTAG -3'
Posted On 2015-01-23