Mutagenetix > Incidental Mutation

Incidental Mutation 'R6632:Cep164'

525225

Institutional Source

Beutler Lab

Gene Symbol

Cep164

Ensembl Gene

ENSMUSG00000043987

Gene Name

centrosomal protein 164

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6632 (G1)

Quality Score

214.009

Status

Validated

Chromosome

Chromosomal Location

45766946-45828691 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 45779790 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 1231 (K1231E)

Ref Sequence

ENSEMBL: ENSMUSP00000149815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117194] [ENSMUST00000213154] [ENSMUST00000216284] [ENSMUST00000217554]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000117194
AA Change: K530E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000114053
Gene: ENSMUSG00000043987
AA Change: K530E

Domain	Start	End	E-Value	Type
WW	57	89	1.99e-3	SMART
low complexity region	110	127	N/A	INTRINSIC
low complexity region	189	201	N/A	INTRINSIC
low complexity region	210	229	N/A	INTRINSIC
low complexity region	362	375	N/A	INTRINSIC
coiled coil region	511	735	N/A	INTRINSIC
low complexity region	741	756	N/A	INTRINSIC
coiled coil region	761	931	N/A	INTRINSIC
low complexity region	956	962	N/A	INTRINSIC
coiled coil region	1057	1084	N/A	INTRINSIC
low complexity region	1095	1110	N/A	INTRINSIC
low complexity region	1141	1168	N/A	INTRINSIC
low complexity region	1185	1195	N/A	INTRINSIC
low complexity region	1235	1248	N/A	INTRINSIC
low complexity region	1309	1318	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000132430
AA Change: K407E

SMART Domains

Protein: ENSMUSP00000117344
Gene: ENSMUSG00000043987
AA Change: K407E

Domain	Start	End	E-Value	Type
low complexity region	141	154	N/A	INTRINSIC
coiled coil region	325	612	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213154
AA Change: K1231E

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000216284
AA Change: K370E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000217554

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.3%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein involved in microtubule organization, DNA damage response, and chromosome segregation. The encoded protein is required for assembly of primary cilia and localizes to mature centrioles. Defects in this gene are a cause of nephronophthisis-related ciliopathies. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,281,067	S758P	possibly damaging	Het
Abca3	C	G	17: 24,384,470	D545E	probably benign	Het
Akap9	T	A	5: 4,013,842		probably null	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Arpp21	G	A	9: 112,127,356	Q518*	probably null	Het
Atp9b	G	A	18: 80,808,649	R410W	probably damaging	Het
Cacna2d3	T	C	14: 28,905,265	*265W	probably null	Het
Ccdc96	G	A	5: 36,485,189	E180K	probably benign	Het
Cnot1	A	G	8: 95,773,267		probably benign	Het
Cpne2	T	C	8: 94,554,955	V206A	probably benign	Het
Dchs1	A	G	7: 105,761,878	Y1647H	probably damaging	Het
Dnaaf5	A	G	5: 139,170,333	T590A	probably benign	Het
Eif4g1	A	T	16: 20,685,520	I1068F	probably damaging	Het
Ephb4	A	T	5: 137,366,587	K639N	probably damaging	Het
Gcc2	A	G	10: 58,270,049		probably null	Het
Gm35315	A	C	5: 110,079,263	Y103*	probably null	Het
Hsd17b4	A	G	18: 50,179,102	K578R	possibly damaging	Het
Ice2	T	C	9: 69,428,452	S906P	probably benign	Het
Irx4	G	T	13: 73,268,426	A314S	probably benign	Het
Lama5	G	A	2: 180,191,662	P1519L	probably damaging	Het
Lrp1b	A	T	2: 40,725,442	W3650R	probably benign	Het
Mcoln3	C	T	3: 146,128,187	H161Y	probably benign	Het
Mphosph10	A	T	7: 64,385,819	M368K	probably damaging	Het
Msh2	A	C	17: 87,712,666	K567Q	possibly damaging	Het
N4bp3	T	C	11: 51,643,949	E429G	possibly damaging	Het
Nrxn3	G	A	12: 89,193,154	A17T	probably damaging	Het
Olfr1459	T	A	19: 13,146,188	Y157F	probably benign	Het
Olfr171	T	C	16: 19,625,023	T26A	probably benign	Het
P4ha2	G	T	11: 54,117,648	R227L	probably benign	Het
Pfkfb4	G	A	9: 109,009,562		probably null	Het
Ror1	A	G	4: 100,442,106	N892S	probably benign	Het
Scn9a	G	T	2: 66,483,502	D1957E	probably benign	Het
Sec24a	A	T	11: 51,713,649	Y713*	probably null	Het
Serpinb1b	T	A	13: 33,087,455	F70I	probably damaging	Het
Setdb1	T	C	3: 95,324,149	Y1284C	probably damaging	Het
Suco	A	T	1: 161,828,240	M1030K	possibly damaging	Het
Syne1	A	T	10: 5,215,667		probably null	Het

Other mutations in Cep164

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00983:Cep164	APN	9	45775256	missense	possibly damaging	0.46
IGL01571:Cep164	APN	9	45794338	missense	possibly damaging	0.82
IGL01985:Cep164	APN	9	45779606	missense	probably damaging	1.00
IGL01989:Cep164	APN	9	45793015	splice site	probably benign
IGL02130:Cep164	APN	9	45779792	missense	possibly damaging	0.82
IGL02598:Cep164	APN	9	45770704	missense	probably damaging	1.00
IGL03206:Cep164	APN	9	45802725	missense	probably benign	0.00
R0063:Cep164	UTSW	9	45768618	missense	possibly damaging	0.83
R0109:Cep164	UTSW	9	45771587	missense	probably damaging	1.00
R0528:Cep164	UTSW	9	45776936	unclassified	probably benign
R0532:Cep164	UTSW	9	45809826	nonsense	probably null
R1445:Cep164	UTSW	9	45778900	missense	possibly damaging	0.66
R1753:Cep164	UTSW	9	45792937	missense	probably damaging	0.99
R1824:Cep164	UTSW	9	45778928	missense	probably damaging	1.00
R1856:Cep164	UTSW	9	45775758	splice site	probably null
R1858:Cep164	UTSW	9	45823640	splice site	probably benign
R1900:Cep164	UTSW	9	45809825	missense	probably damaging	1.00
R1911:Cep164	UTSW	9	45770806	missense	probably benign	0.09
R2032:Cep164	UTSW	9	45771600	missense	probably damaging	1.00
R2133:Cep164	UTSW	9	45803183	missense	probably damaging	1.00
R2186:Cep164	UTSW	9	45768578	missense	probably damaging	1.00
R2511:Cep164	UTSW	9	45775249	missense	probably damaging	1.00
R4424:Cep164	UTSW	9	45779704	missense	possibly damaging	0.92
R5126:Cep164	UTSW	9	45787424	critical splice donor site	probably null
R5997:Cep164	UTSW	9	45769463	missense	possibly damaging	0.92
R6186:Cep164	UTSW	9	45794109	missense	probably damaging	0.98
R6357:Cep164	UTSW	9	45770884	missense	probably damaging	1.00
R6385:Cep164	UTSW	9	45779783	missense	probably damaging	0.99
R6957:Cep164	UTSW	9	45772280	critical splice donor site	probably null
R7310:Cep164	UTSW	9	45775366	missense	probably damaging	1.00
R7420:Cep164	UTSW	9	45768542	missense	probably benign	0.01
R7651:Cep164	UTSW	9	45773852	missense	probably benign	0.18
R7918:Cep164	UTSW	9	45779688	critical splice donor site	probably null
R7982:Cep164	UTSW	9	45778864	missense	probably benign	0.40
R8010:Cep164	UTSW	9	45823671	missense	unknown
R8391:Cep164	UTSW	9	45807193	missense	unknown
R8553:Cep164	UTSW	9	45807210	unclassified	probably benign
R8700:Cep164	UTSW	9	45775369	critical splice acceptor site	probably null
R9177:Cep164	UTSW	9	45779762	missense	probably damaging	1.00
R9348:Cep164	UTSW	9	45806410	missense	unknown
R9460:Cep164	UTSW	9	45773984	missense	probably benign
R9729:Cep164	UTSW	9	45771599	missense	probably damaging	1.00
X0024:Cep164	UTSW	9	45775863	critical splice donor site	probably null
X0028:Cep164	UTSW	9	45770967	missense	probably damaging	1.00
X0065:Cep164	UTSW	9	45774787	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TTCTCGAAGCCTCTGTAGGG -3'
(R):5'- CTATGAGGGACCTACATGGATGAG -3'

Sequencing Primer
(F):5'- TCGGTTCTGGGCAGAGAGAC -3'
(R):5'- CTACATGGATGAGAAGTTGACTGATC -3'

Posted On

2018-06-22