Incidental Mutation 'R6572:Apc2'
ID526288
Institutional Source Beutler Lab
Gene Symbol Apc2
Ensembl Gene ENSMUSG00000020135
Gene Nameadenomatosis polyposis coli 2
SynonymsAPCL
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R6572 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80295977-80318263 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80311779 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 860 (S860L)
Ref Sequence ENSEMBL: ENSMUSP00000020349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020349] [ENSMUST00000105359]
Predicted Effect probably damaging
Transcript: ENSMUST00000020349
AA Change: S860L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020349
Gene: ENSMUSG00000020135
AA Change: S860L

DomainStartEndE-ValueType
PDB:1DEB|B 4 57 9e-17 PDB
Pfam:Suppressor_APC 123 205 1.3e-28 PFAM
coiled coil region 214 236 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
ARM 300 355 2.95e0 SMART
ARM 417 468 2.22e-2 SMART
ARM 470 511 3.22e0 SMART
ARM 513 555 3.56e-1 SMART
ARM 557 602 2.1e1 SMART
ARM 607 647 1.82e-7 SMART
Blast:ARM 649 689 6e-18 BLAST
low complexity region 772 792 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1087 1103 N/A INTRINSIC
Pfam:APC_crr 1134 1159 4.4e-9 PFAM
low complexity region 1197 1208 N/A INTRINSIC
Pfam:APC_crr 1244 1269 4.1e-8 PFAM
Pfam:SAMP 1323 1343 2.1e-10 PFAM
Pfam:APC_crr 1369 1394 5.8e-8 PFAM
low complexity region 1500 1516 N/A INTRINSIC
Pfam:APC_crr 1540 1565 5.7e-8 PFAM
Pfam:SAMP 1594 1613 8.8e-11 PFAM
low complexity region 1673 1699 N/A INTRINSIC
Pfam:APC_basic 1757 2093 1.1e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105359
AA Change: S889L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100996
Gene: ENSMUSG00000020135
AA Change: S889L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:APC_N_CC 30 81 2.7e-34 PFAM
Pfam:Suppressor_APC 148 228 1.4e-27 PFAM
coiled coil region 238 260 N/A INTRINSIC
low complexity region 266 285 N/A INTRINSIC
ARM 324 379 2.95e0 SMART
ARM 446 497 2.22e-2 SMART
ARM 499 540 3.22e0 SMART
ARM 542 584 3.56e-1 SMART
ARM 586 631 2.1e1 SMART
ARM 636 676 1.82e-7 SMART
Blast:ARM 678 718 6e-18 BLAST
Pfam:Arm_APC_u3 719 977 1.1e-26 PFAM
low complexity region 1000 1009 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
Pfam:APC_crr 1164 1187 9.3e-8 PFAM
low complexity region 1226 1237 N/A INTRINSIC
Pfam:APC_crr 1274 1297 7.9e-10 PFAM
Pfam:APC_crr 1399 1423 1.3e-9 PFAM
low complexity region 1529 1545 N/A INTRINSIC
low complexity region 1585 1603 N/A INTRINSIC
Pfam:SAMP 1624 1642 1.3e-11 PFAM
low complexity region 1702 1728 N/A INTRINSIC
Pfam:APC_basic 1786 2122 1.3e-122 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (62/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display gradual postnatal growth retardation, abnormal lamination of the cerebral cortex, hippocampus, olfactory bulb and cerebellum, impaired neuronal migration and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik C T 15: 37,425,717 Q34* probably null Het
Adamts3 T A 5: 89,861,609 H65L possibly damaging Het
Ago2 A G 15: 73,126,977 V257A probably benign Het
Ahnak A G 19: 9,007,976 K2208R probably damaging Het
Arhgap18 A G 10: 26,846,416 probably null Het
Arhgap33 T C 7: 30,527,210 E524G probably damaging Het
Ascc3 C T 10: 50,690,247 Q763* probably null Het
Atg2a T C 19: 6,254,665 L1184P probably damaging Het
Baiap2l1 A G 5: 144,286,302 L75P probably damaging Het
Btbd17 A T 11: 114,792,220 L222Q probably damaging Het
Chst13 G T 6: 90,309,606 R125S probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Cracr2a T C 6: 127,608,752 probably null Het
Dchs1 T A 7: 105,758,806 T1940S possibly damaging Het
Ddit4l G T 3: 137,626,350 R159L probably benign Het
Dock3 A G 9: 106,989,475 Y679H probably damaging Het
Dyrk4 T G 6: 126,897,238 I130L probably benign Het
Eml2 T C 7: 19,196,614 V373A possibly damaging Het
Ephb1 A G 9: 102,066,898 F312L probably benign Het
Fam189a2 A T 19: 23,984,718 M307K possibly damaging Het
Fndc9 A T 11: 46,237,881 I76F probably damaging Het
Frk G A 10: 34,583,967 R186K probably benign Het
Gpatch3 G T 4: 133,574,880 G41C probably damaging Het
Greb1l T A 18: 10,522,131 H633Q probably benign Het
Gstt4 T A 10: 75,815,120 T223S probably damaging Het
Hpd C T 5: 123,180,676 E60K probably benign Het
Inpp5d C T 1: 87,695,396 P403S probably damaging Het
Klk1b9 T A 7: 43,979,735 I189K probably benign Het
Kmt2e A T 5: 23,497,581 H239L possibly damaging Het
Lrriq3 A G 3: 155,181,675 D344G probably benign Het
Neb A G 2: 52,278,847 I1892T probably damaging Het
Neto2 A T 8: 85,670,404 I73N possibly damaging Het
Nipal3 A T 4: 135,447,253 S396T probably benign Het
Olfr395 A G 11: 73,906,803 S230P possibly damaging Het
Olfr638 T A 7: 103,999,184 probably null Het
Phf20l1 T A 15: 66,609,547 V264D probably damaging Het
Pigs A G 11: 78,339,364 Y319C probably damaging Het
Pkd2l2 T C 18: 34,438,771 Y608H probably damaging Het
Ppard G T 17: 28,297,119 E106* probably null Het
Pramef25 A G 4: 143,949,692 S281P probably benign Het
Pramef6 C T 4: 143,895,373 V471I possibly damaging Het
Psenen T C 7: 30,562,348 T48A probably benign Het
Ralgps2 A T 1: 156,824,050 probably null Het
Ripk4 T A 16: 97,745,905 R323* probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Scgb2b24 T A 7: 33,738,477 E68D probably damaging Het
Setx A G 2: 29,173,694 D2334G possibly damaging Het
Sh3bp4 A G 1: 89,144,921 D497G possibly damaging Het
Smarca2 A T 19: 26,679,173 I850F possibly damaging Het
Smyd1 A G 6: 71,225,412 Y270H probably damaging Het
Spidr T A 16: 15,912,516 probably null Het
Srms T C 2: 181,212,657 D39G probably benign Het
Trpc2 T A 7: 102,090,006 I528N probably damaging Het
Tshr A G 12: 91,538,360 I691V probably benign Het
Urb1 A C 16: 90,787,414 V560G probably benign Het
Usp37 A G 1: 74,495,782 S2P possibly damaging Het
Vmn1r60 G A 7: 5,544,600 S167F probably benign Het
Vmn2r89 G A 14: 51,455,993 V267I probably damaging Het
Washc3 T A 10: 88,213,706 D63E probably benign Het
Wdr89 A G 12: 75,633,385 S32P probably damaging Het
Zfp157 T C 5: 138,457,051 S504P possibly damaging Het
Other mutations in Apc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Apc2 APN 10 80311986 missense probably damaging 1.00
IGL01154:Apc2 APN 10 80313069 missense possibly damaging 0.90
IGL01411:Apc2 APN 10 80315078 missense probably damaging 0.99
IGL01598:Apc2 APN 10 80313048 missense probably damaging 1.00
IGL01621:Apc2 APN 10 80306201 missense probably damaging 1.00
IGL01720:Apc2 APN 10 80314499 missense probably benign 0.01
IGL01837:Apc2 APN 10 80314658 missense probably benign 0.24
IGL01933:Apc2 APN 10 80311740 missense probably damaging 1.00
IGL02243:Apc2 APN 10 80302341 missense probably damaging 1.00
IGL02292:Apc2 APN 10 80302424 missense possibly damaging 0.59
IGL02956:Apc2 APN 10 80306375 missense probably damaging 1.00
IGL03081:Apc2 APN 10 80312252 missense probably damaging 1.00
IGL03172:Apc2 APN 10 80313386 missense probably damaging 0.98
LCD18:Apc2 UTSW 10 80299974 intron probably benign
R0278:Apc2 UTSW 10 80312813 missense possibly damaging 0.90
R0501:Apc2 UTSW 10 80315124 missense probably damaging 1.00
R0594:Apc2 UTSW 10 80306256 nonsense probably null
R0607:Apc2 UTSW 10 80314101 missense probably benign
R0624:Apc2 UTSW 10 80314583 missense probably benign 0.00
R0633:Apc2 UTSW 10 80307455 missense probably damaging 0.99
R0638:Apc2 UTSW 10 80304967 missense probably damaging 0.99
R0647:Apc2 UTSW 10 80304928 missense probably damaging 1.00
R0830:Apc2 UTSW 10 80315405 missense probably damaging 1.00
R1071:Apc2 UTSW 10 80311502 missense probably damaging 1.00
R1221:Apc2 UTSW 10 80306380 missense probably damaging 1.00
R1432:Apc2 UTSW 10 80312349 missense probably benign 0.00
R1579:Apc2 UTSW 10 80311345 missense probably damaging 1.00
R1654:Apc2 UTSW 10 80301842 missense possibly damaging 0.75
R1700:Apc2 UTSW 10 80312769 missense probably damaging 1.00
R1774:Apc2 UTSW 10 80309130 missense probably damaging 1.00
R1864:Apc2 UTSW 10 80313648 missense probably damaging 1.00
R1908:Apc2 UTSW 10 80314844 missense probably benign 0.05
R1915:Apc2 UTSW 10 80315867 missense probably benign
R1999:Apc2 UTSW 10 80309160 missense probably damaging 1.00
R2050:Apc2 UTSW 10 80307609 intron probably null
R2219:Apc2 UTSW 10 80309109 missense probably benign 0.41
R2393:Apc2 UTSW 10 80313069 missense possibly damaging 0.90
R3862:Apc2 UTSW 10 80307559 missense possibly damaging 0.82
R3900:Apc2 UTSW 10 80295972 unclassified probably null
R3901:Apc2 UTSW 10 80315088 missense possibly damaging 0.94
R3952:Apc2 UTSW 10 80314484 missense probably damaging 1.00
R4009:Apc2 UTSW 10 80313592 missense probably benign 0.00
R4090:Apc2 UTSW 10 80305544 missense probably damaging 0.97
R4695:Apc2 UTSW 10 80311043 missense probably damaging 1.00
R4754:Apc2 UTSW 10 80314358 missense probably benign 0.01
R4807:Apc2 UTSW 10 80314362 missense probably benign 0.13
R4886:Apc2 UTSW 10 80314213 missense probably damaging 1.00
R4964:Apc2 UTSW 10 80314007 missense probably benign 0.14
R5056:Apc2 UTSW 10 80301314 missense probably benign
R5057:Apc2 UTSW 10 80309069 missense probably damaging 0.99
R5165:Apc2 UTSW 10 80315850 missense probably damaging 0.99
R5241:Apc2 UTSW 10 80312234 missense probably benign
R5649:Apc2 UTSW 10 80314138 missense probably damaging 1.00
R5924:Apc2 UTSW 10 80312150 missense probably damaging 1.00
R6124:Apc2 UTSW 10 80306351 missense probably damaging 0.98
R6218:Apc2 UTSW 10 80306420 missense probably damaging 0.98
R6376:Apc2 UTSW 10 80312654 missense probably damaging 1.00
R6490:Apc2 UTSW 10 80313923 missense probably benign 0.01
R6620:Apc2 UTSW 10 80313567 missense probably damaging 0.97
R7171:Apc2 UTSW 10 80315336 missense possibly damaging 0.65
R7180:Apc2 UTSW 10 80311156 missense possibly damaging 0.94
R7326:Apc2 UTSW 10 80311740 missense probably damaging 1.00
R7340:Apc2 UTSW 10 80313482 missense probably benign 0.12
R7378:Apc2 UTSW 10 80311394 missense probably damaging 1.00
R7384:Apc2 UTSW 10 80312624 missense probably damaging 1.00
R7431:Apc2 UTSW 10 80302183 missense possibly damaging 0.83
R7543:Apc2 UTSW 10 80314886 missense possibly damaging 0.72
R7743:Apc2 UTSW 10 80304915 missense probably damaging 0.99
R7759:Apc2 UTSW 10 80311196 missense probably damaging 1.00
X0018:Apc2 UTSW 10 80312264 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCCCAGCAGTGATGTCTATG -3'
(R):5'- TGGTGCTACCGCTGTTCAAG -3'

Sequencing Primer
(F):5'- CCAGCAGTGATGTCTATGTTCCTTG -3'
(R):5'- CTGTTCAAGCTATCATTAGAGAGGC -3'
Posted On2018-06-22