Incidental Mutation 'R6572:Neto2'
ID526282
Institutional Source Beutler Lab
Gene Symbol Neto2
Ensembl Gene ENSMUSG00000036902
Gene Nameneuropilin (NRP) and tolloid (TLL)-like 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R6572 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location85636588-85700924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85670404 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 73 (I73N)
Ref Sequence ENSEMBL: ENSMUSP00000150062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109686
AA Change: I108N

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: I108N

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
CUB 80 194 2.56e-40 SMART
CUB 205 320 9.11e-5 SMART
LDLa 324 361 5.73e-5 SMART
transmembrane domain 374 396 N/A INTRINSIC
coiled coil region 432 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209259
Predicted Effect possibly damaging
Transcript: ENSMUST00000209479
AA Change: I73N

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215046
Predicted Effect possibly damaging
Transcript: ENSMUST00000216286
AA Change: I73N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik C T 15: 37,425,717 Q34* probably null Het
Adamts3 T A 5: 89,861,609 H65L possibly damaging Het
Ago2 A G 15: 73,126,977 V257A probably benign Het
Ahnak A G 19: 9,007,976 K2208R probably damaging Het
Apc2 C T 10: 80,311,779 S860L probably damaging Het
Arhgap18 A G 10: 26,846,416 probably null Het
Arhgap33 T C 7: 30,527,210 E524G probably damaging Het
Ascc3 C T 10: 50,690,247 Q763* probably null Het
Atg2a T C 19: 6,254,665 L1184P probably damaging Het
Baiap2l1 A G 5: 144,286,302 L75P probably damaging Het
Btbd17 A T 11: 114,792,220 L222Q probably damaging Het
Chst13 G T 6: 90,309,606 R125S probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Cracr2a T C 6: 127,608,752 probably null Het
Dchs1 T A 7: 105,758,806 T1940S possibly damaging Het
Ddit4l G T 3: 137,626,350 R159L probably benign Het
Dock3 A G 9: 106,989,475 Y679H probably damaging Het
Dyrk4 T G 6: 126,897,238 I130L probably benign Het
Eml2 T C 7: 19,196,614 V373A possibly damaging Het
Ephb1 A G 9: 102,066,898 F312L probably benign Het
Fam189a2 A T 19: 23,984,718 M307K possibly damaging Het
Fndc9 A T 11: 46,237,881 I76F probably damaging Het
Frk G A 10: 34,583,967 R186K probably benign Het
Gpatch3 G T 4: 133,574,880 G41C probably damaging Het
Greb1l T A 18: 10,522,131 H633Q probably benign Het
Gstt4 T A 10: 75,815,120 T223S probably damaging Het
Hpd C T 5: 123,180,676 E60K probably benign Het
Inpp5d C T 1: 87,695,396 P403S probably damaging Het
Klk1b9 T A 7: 43,979,735 I189K probably benign Het
Kmt2e A T 5: 23,497,581 H239L possibly damaging Het
Lrriq3 A G 3: 155,181,675 D344G probably benign Het
Neb A G 2: 52,278,847 I1892T probably damaging Het
Nipal3 A T 4: 135,447,253 S396T probably benign Het
Olfr395 A G 11: 73,906,803 S230P possibly damaging Het
Olfr638 T A 7: 103,999,184 probably null Het
Phf20l1 T A 15: 66,609,547 V264D probably damaging Het
Pigs A G 11: 78,339,364 Y319C probably damaging Het
Pkd2l2 T C 18: 34,438,771 Y608H probably damaging Het
Ppard G T 17: 28,297,119 E106* probably null Het
Pramef25 A G 4: 143,949,692 S281P probably benign Het
Pramef6 C T 4: 143,895,373 V471I possibly damaging Het
Psenen T C 7: 30,562,348 T48A probably benign Het
Ralgps2 A T 1: 156,824,050 probably null Het
Ripk4 T A 16: 97,745,905 R323* probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Scgb2b24 T A 7: 33,738,477 E68D probably damaging Het
Setx A G 2: 29,173,694 D2334G possibly damaging Het
Sh3bp4 A G 1: 89,144,921 D497G possibly damaging Het
Smarca2 A T 19: 26,679,173 I850F possibly damaging Het
Smyd1 A G 6: 71,225,412 Y270H probably damaging Het
Spidr T A 16: 15,912,516 probably null Het
Srms T C 2: 181,212,657 D39G probably benign Het
Trpc2 T A 7: 102,090,006 I528N probably damaging Het
Tshr A G 12: 91,538,360 I691V probably benign Het
Urb1 A C 16: 90,787,414 V560G probably benign Het
Usp37 A G 1: 74,495,782 S2P possibly damaging Het
Vmn1r60 G A 7: 5,544,600 S167F probably benign Het
Vmn2r89 G A 14: 51,455,993 V267I probably damaging Het
Washc3 T A 10: 88,213,706 D63E probably benign Het
Wdr89 A G 12: 75,633,385 S32P probably damaging Het
Zfp157 T C 5: 138,457,051 S504P possibly damaging Het
Other mutations in Neto2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Neto2 APN 8 85641003 missense probably damaging 1.00
IGL01938:Neto2 APN 8 85690855 missense probably benign 0.00
IGL02238:Neto2 APN 8 85669663 missense probably damaging 0.99
IGL02605:Neto2 APN 8 85663435 splice site probably benign
IGL02813:Neto2 APN 8 85690886 missense probably benign
R0138:Neto2 UTSW 8 85641044 missense possibly damaging 0.72
R1934:Neto2 UTSW 8 85670404 missense possibly damaging 0.96
R2402:Neto2 UTSW 8 85690912 missense probably benign 0.00
R2423:Neto2 UTSW 8 85669767 missense probably damaging 1.00
R3821:Neto2 UTSW 8 85663295 nonsense probably null
R3822:Neto2 UTSW 8 85663295 nonsense probably null
R3883:Neto2 UTSW 8 85663265 missense probably damaging 1.00
R3939:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R3940:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R3941:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R4433:Neto2 UTSW 8 85641083 missense probably damaging 1.00
R4668:Neto2 UTSW 8 85641062 missense probably damaging 1.00
R4675:Neto2 UTSW 8 85669704 missense probably damaging 1.00
R4908:Neto2 UTSW 8 85669764 missense probably damaging 0.99
R5459:Neto2 UTSW 8 85670483 missense probably benign 0.35
R5471:Neto2 UTSW 8 85640760 missense probably benign 0.41
R5544:Neto2 UTSW 8 85647877 missense possibly damaging 0.94
R5571:Neto2 UTSW 8 85640544 missense probably damaging 1.00
R6083:Neto2 UTSW 8 85640585 missense probably benign 0.00
R6339:Neto2 UTSW 8 85640558 missense probably benign 0.33
R6381:Neto2 UTSW 8 85642509 missense probably damaging 0.99
R6593:Neto2 UTSW 8 85669546 missense probably damaging 1.00
R6662:Neto2 UTSW 8 85663215 missense probably damaging 1.00
R6881:Neto2 UTSW 8 85640556 missense probably damaging 1.00
R6950:Neto2 UTSW 8 85670443 missense probably damaging 1.00
R7121:Neto2 UTSW 8 85670391 splice site probably null
Predicted Primers PCR Primer
(F):5'- CATGTGCAAAGGCCCAGTAAG -3'
(R):5'- GCAACAGAGTAGGCAATTGTTTTAG -3'

Sequencing Primer
(F):5'- AGACATCCCTTATCAGAGACGTTTC -3'
(R):5'- AATTGTTTTAGAGTGTTGGAGGAAAG -3'
Posted On2018-06-22