Incidental Mutation 'R6642:Ctrl'
ID526336
Institutional Source Beutler Lab
Gene Symbol Ctrl
Ensembl Gene ENSMUSG00000031896
Gene Namechymotrypsin-like
SynonymsCtra-1, 0910001G08Rik, chymopasin, 1810004D15Rik, Ctra1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6642 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location105932003-105933862 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 105932819 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034368] [ENSMUST00000034369] [ENSMUST00000049699]
Predicted Effect probably null
Transcript: ENSMUST00000034368
SMART Domains Protein: ENSMUSP00000034368
Gene: ENSMUSG00000031896

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Tryp_SPc 33 257 1.41e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034369
SMART Domains Protein: ENSMUSP00000034369
Gene: ENSMUSG00000031897

DomainStartEndE-ValueType
Pfam:Proteasome 36 217 3.9e-49 PFAM
Pfam:Pr_beta_C 231 267 3.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049699
SMART Domains Protein: ENSMUSP00000061700
Gene: ENSMUSG00000048310

DomainStartEndE-ValueType
S_TKc 98 355 1.22e-100 SMART
low complexity region 378 417 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212938
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine-type endopeptidase with chymotrypsin- and elastase-2-like activities. The gene encoding this zymogen is expressed specifically in the pancreas and likely functions as a digestive enzyme. [provided by RefSeq, Sep 2016]
PHENOTYPE: Four alleles of this locus were identified. The a allele in most laboratory strains and M.m. molossinus; the c allele in IS/Cam and M. castaneus lines; the d allele in SEG/1 and SPE/Pas. The b (presumed null) allele is found in PWD/Ph and PWK/Ph. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,870 V215D probably damaging Het
Ablim1 A G 19: 57,130,852 S267P probably benign Het
Adcy2 C T 13: 68,620,826 C1061Y probably damaging Het
Aip C A 19: 4,115,149 C240F probably damaging Het
Aldh1a2 A T 9: 71,252,986 D98V probably damaging Het
Arhgef40 T C 14: 51,990,962 probably benign Het
Cplx2 G T 13: 54,378,923 R48L probably damaging Het
Dnhd1 A G 7: 105,703,799 T2720A probably benign Het
Fzd1 A G 5: 4,755,696 Y629H probably damaging Het
Gins1 T C 2: 150,928,118 probably null Het
Gpr149 C T 3: 62,530,574 A721T probably damaging Het
Helb A T 10: 120,084,930 M1036K probably benign Het
Il16 A G 7: 83,688,127 F127L probably benign Het
Kctd20 A T 17: 28,961,666 H138L probably damaging Het
Kctd9 T A 14: 67,724,673 L55* probably null Het
Marf1 C T 16: 14,132,747 R925H probably benign Het
Mbip A T 12: 56,342,406 probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nod1 T G 6: 54,948,029 D99A probably damaging Het
Olfm4 A G 14: 80,021,667 K419E probably damaging Het
Olfr807 A T 10: 129,755,363 L29Q probably damaging Het
Pik3r4 A G 9: 105,644,646 D137G probably benign Het
Prdm4 T C 10: 85,907,818 E191G probably benign Het
Rassf10 A T 7: 112,955,577 T462S probably benign Het
Rundc3b A T 5: 8,579,071 I110N probably damaging Het
Sgsm3 C T 15: 81,009,700 R479C probably damaging Het
Tmc7 A T 7: 118,545,611 Y575* probably null Het
Trim33 T C 3: 103,337,514 L310S probably damaging Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Ttn T C 2: 76,735,396 E28204G probably damaging Het
Vmn1r233 A T 17: 20,993,740 L316Q probably damaging Het
Vmn2r110 A T 17: 20,583,517 N265K possibly damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Ctrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Ctrl APN 8 105933258 unclassified probably benign
IGL01791:Ctrl APN 8 105932567 missense probably benign 0.01
R0546:Ctrl UTSW 8 105932334 missense probably damaging 1.00
R5479:Ctrl UTSW 8 105933040 missense probably damaging 1.00
R7867:Ctrl UTSW 8 105932865 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTTCAGGAGAGTCAGGTC -3'
(R):5'- TGGTTCTCTCATCAGTCCGAAC -3'

Sequencing Primer
(F):5'- CAGGAGAGTCAGGTCATTGTTC -3'
(R):5'- AGTCCGAACTGGGTGGTCAC -3'
Posted On2018-06-22