Incidental Mutation 'R6642:Mbip'
ID543605
Institutional Source Beutler Lab
Gene Symbol Mbip
Ensembl Gene ENSMUSG00000021028
Gene NameMAP3K12 binding inhibitory protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R6642 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location56328303-56345894 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 56342406 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021416] [ENSMUST00000218118]
Predicted Effect probably benign
Transcript: ENSMUST00000021416
SMART Domains Protein: ENSMUSP00000021416
Gene: ENSMUSG00000021028

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
coiled coil region 311 335 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000218118
AA Change: Y45N
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,870 V215D probably damaging Het
Ablim1 A G 19: 57,130,852 S267P probably benign Het
Adcy2 C T 13: 68,620,826 C1061Y probably damaging Het
Aip C A 19: 4,115,149 C240F probably damaging Het
Aldh1a2 A T 9: 71,252,986 D98V probably damaging Het
Arhgef40 T C 14: 51,990,962 probably benign Het
Cplx2 G T 13: 54,378,923 R48L probably damaging Het
Ctrl C T 8: 105,932,819 probably null Het
Dnhd1 A G 7: 105,703,799 T2720A probably benign Het
Fzd1 A G 5: 4,755,696 Y629H probably damaging Het
Gins1 T C 2: 150,928,118 probably null Het
Gpr149 C T 3: 62,530,574 A721T probably damaging Het
Helb A T 10: 120,084,930 M1036K probably benign Het
Il16 A G 7: 83,688,127 F127L probably benign Het
Kctd20 A T 17: 28,961,666 H138L probably damaging Het
Kctd9 T A 14: 67,724,673 L55* probably null Het
Marf1 C T 16: 14,132,747 R925H probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nod1 T G 6: 54,948,029 D99A probably damaging Het
Olfm4 A G 14: 80,021,667 K419E probably damaging Het
Olfr807 A T 10: 129,755,363 L29Q probably damaging Het
Pik3r4 A G 9: 105,644,646 D137G probably benign Het
Prdm4 T C 10: 85,907,818 E191G probably benign Het
Rassf10 A T 7: 112,955,577 T462S probably benign Het
Rundc3b A T 5: 8,579,071 I110N probably damaging Het
Sgsm3 C T 15: 81,009,700 R479C probably damaging Het
Tmc7 A T 7: 118,545,611 Y575* probably null Het
Trim33 T C 3: 103,337,514 L310S probably damaging Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Ttn T C 2: 76,735,396 E28204G probably damaging Het
Vmn1r233 A T 17: 20,993,740 L316Q probably damaging Het
Vmn2r110 A T 17: 20,583,517 N265K possibly damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Mbip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Mbip APN 12 56330242 missense probably benign 0.35
IGL02627:Mbip APN 12 56335805 missense probably benign 0.06
IGL03244:Mbip APN 12 56337762 critical splice donor site probably null
IGL03387:Mbip APN 12 56335812 missense probably damaging 1.00
R0891:Mbip UTSW 12 56340457 missense possibly damaging 0.93
R3119:Mbip UTSW 12 56345703 missense probably benign 0.00
R5254:Mbip UTSW 12 56337443 missense probably damaging 0.99
R5584:Mbip UTSW 12 56335862 missense probably damaging 1.00
R5853:Mbip UTSW 12 56335877 missense probably damaging 1.00
R6808:Mbip UTSW 12 56337598 splice site probably null
R7231:Mbip UTSW 12 56337762 critical splice donor site probably null
R7716:Mbip UTSW 12 56345688 missense probably benign 0.00
Z1176:Mbip UTSW 12 56340385 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGATCACTAGTGAAATTAACAGACC -3'
(R):5'- TCAAAGATGGCCCCAGGAAC -3'

Sequencing Primer
(F):5'- CTGTTAACAGAATGTTGAGGTAGAAC -3'
(R):5'- ATGGCAACTGGGTAAAGC -3'
Posted On2019-03-29