Incidental Mutation 'R6682:Myoz1'
ID527553
Institutional Source Beutler Lab
Gene Symbol Myoz1
Ensembl Gene ENSMUSG00000068697
Gene Namemyozenin 1
Synonyms2310001N11Rik, FATZ, calsarcin-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6682 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location20649107-20656540 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 20653619 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090469]
Predicted Effect probably null
Transcript: ENSMUST00000090469
SMART Domains Protein: ENSMUSP00000087955
Gene: ENSMUSG00000068697

DomainStartEndE-ValueType
Pfam:Calsarcin 1 296 1.9e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225231
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is primarily expressed in the skeletal muscle, and belongs to the myozenin family. Members of this family function as calcineurin-interacting proteins that help tether calcineurin to the sarcomere of cardiac and skeletal muscle. They play an important role in modulation of calcineurin signaling. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body weight and fast-twitch muscle mass, a fiber type shift toward more oxidative fibers, increased exercise capacity and calcineurin activity, and enhanced muscle regeneration after cardiotoxin injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp704 T C 3: 9,565,193 E36G probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Myoz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Myoz1 APN 14 20655309 missense probably damaging 0.98
R0081:Myoz1 UTSW 14 20649554 missense probably benign 0.08
R0826:Myoz1 UTSW 14 20653611 splice site probably benign
R0893:Myoz1 UTSW 14 20651184 missense probably benign 0.16
R1029:Myoz1 UTSW 14 20650532 missense probably damaging 1.00
R3078:Myoz1 UTSW 14 20653617 splice site probably benign
R4584:Myoz1 UTSW 14 20650595 missense probably damaging 1.00
R4585:Myoz1 UTSW 14 20650595 missense probably damaging 1.00
R4586:Myoz1 UTSW 14 20650595 missense probably damaging 1.00
R4830:Myoz1 UTSW 14 20655309 missense probably damaging 0.98
R4912:Myoz1 UTSW 14 20649538 missense probably damaging 1.00
R5001:Myoz1 UTSW 14 20653701 missense probably damaging 0.99
R5015:Myoz1 UTSW 14 20653719 missense probably benign 0.42
R5120:Myoz1 UTSW 14 20650654 missense probably benign 0.00
R7097:Myoz1 UTSW 14 20649409 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATGGACTGTTACCCACCCTAGAC -3'
(R):5'- TCCAGAAAGCCCTCATTTCC -3'

Sequencing Primer
(F):5'- CACCCTAGACTGGTTGGGAATG -3'
(R):5'- GATTCTTCTCTACCTCCTGGATAAG -3'
Posted On2018-07-23