Incidental Mutation 'R6682:Uhmk1'
ID 527524
Institutional Source Beutler Lab
Gene Symbol Uhmk1
Ensembl Gene ENSMUSG00000026667
Gene Name U2AF homology motif (UHM) kinase 1
Synonyms C820018A03Rik, Kist, OTTMUSG00000021542, KIS
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.856) question?
Stock # R6682 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 170193420-170215397 bp(-) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 170212235 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027979] [ENSMUST00000123399] [ENSMUST00000150821]
AlphaFold P97343
Predicted Effect probably null
Transcript: ENSMUST00000027979
SMART Domains Protein: ENSMUSP00000027979
Gene: ENSMUSG00000026667

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 23 298 4.1e-22 PFAM
Pfam:Pkinase 23 304 1.3e-40 PFAM
Pfam:Kdo 65 187 2.6e-7 PFAM
RRM 320 402 2.47e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000123399
SMART Domains Protein: ENSMUSP00000120787
Gene: ENSMUSG00000026667

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 23 299 1.8e-22 PFAM
Pfam:Pkinase 23 304 4.6e-43 PFAM
low complexity region 325 341 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150821
SMART Domains Protein: ENSMUSP00000115622
Gene: ENSMUSG00000026667

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 210 7e-16 PFAM
Pfam:Pkinase 2 215 1.2e-34 PFAM
RRM 231 313 2.47e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159201
SMART Domains Protein: ENSMUSP00000125148
Gene: ENSMUSG00000044306

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 114 132 N/A INTRINSIC
low complexity region 145 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194988
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a serine/threonine protein kinase that promotes cell cycle progression through G1 by phosphorylation of the cyclin-dependent kinase inhibitor 1B (p27Kip1), which causes nuclear export and degradation. The encoded protein is also thought to function in the adult nervous system and the gene has been associated with schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice with disruptions in this gene show accelerated development of neointima after arterial injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp704 T C 3: 9,565,193 E36G probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Uhmk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Uhmk1 APN 1 170207113 critical splice donor site probably null
IGL02451:Uhmk1 APN 1 170212526 missense possibly damaging 0.89
R0452:Uhmk1 UTSW 1 170212402 missense possibly damaging 0.92
R0507:Uhmk1 UTSW 1 170207191 missense probably damaging 1.00
R1466:Uhmk1 UTSW 1 170208653 critical splice donor site probably null
R1466:Uhmk1 UTSW 1 170208653 critical splice donor site probably null
R1584:Uhmk1 UTSW 1 170208653 critical splice donor site probably null
R1676:Uhmk1 UTSW 1 170200012 missense probably damaging 1.00
R1806:Uhmk1 UTSW 1 170211059 missense probably damaging 0.98
R2039:Uhmk1 UTSW 1 170212267 missense probably damaging 1.00
R4567:Uhmk1 UTSW 1 170205117 nonsense probably null
R4658:Uhmk1 UTSW 1 170207205 missense probably damaging 1.00
R4765:Uhmk1 UTSW 1 170199901 missense probably damaging 1.00
R5186:Uhmk1 UTSW 1 170211167 missense probably damaging 1.00
R5686:Uhmk1 UTSW 1 170211218 missense probably damaging 1.00
R6210:Uhmk1 UTSW 1 170212237 missense probably damaging 1.00
R6238:Uhmk1 UTSW 1 170199994 missense probably damaging 0.99
R6253:Uhmk1 UTSW 1 170199880 missense probably damaging 1.00
R7522:Uhmk1 UTSW 1 170215240 start codon destroyed probably benign 0.00
R7582:Uhmk1 UTSW 1 170200001 missense probably damaging 1.00
R7916:Uhmk1 UTSW 1 170205188 missense possibly damaging 0.46
R9097:Uhmk1 UTSW 1 170215310 unclassified probably benign
R9483:Uhmk1 UTSW 1 170207344 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCGTCAGTCCCTAAATTACCATTG -3'
(R):5'- CATGTGGATGATACAGCACTGTG -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- ATGATACAGCACTGTGCCCGAG -3'
Posted On 2018-07-23