Incidental Mutation 'R6682:Wdr41'
ID 527551
Institutional Source Beutler Lab
Gene Symbol Wdr41
Ensembl Gene ENSMUSG00000042015
Gene Name WD repeat domain 41
Synonyms B830029I03Rik, MSTP048
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6682 (G1)
Quality Score 147.008
Status Not validated
Chromosome 13
Chromosomal Location 94976344-95023314 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 95013131 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 419 (G419D)
Ref Sequence ENSEMBL: ENSMUSP00000138543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056512] [ENSMUST00000159647] [ENSMUST00000160115] [ENSMUST00000160801] [ENSMUST00000167155] [ENSMUST00000222995]
AlphaFold Q3UDP0
Predicted Effect probably benign
Transcript: ENSMUST00000056512
SMART Domains Protein: ENSMUSP00000055145
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
WD40 211 249 2.86e0 SMART
WD40 308 350 7.92e-3 SMART
WD40 394 432 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159647
AA Change: G281D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138501
Gene: ENSMUSG00000042015
AA Change: G281D

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
Blast:WD40 162 199 9e-6 BLAST
internal_repeat_1 233 260 6.23e-8 PROSPERO
internal_repeat_1 269 309 6.23e-8 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000160115
AA Change: G419D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138543
Gene: ENSMUSG00000042015
AA Change: G419D

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
Blast:WD40 162 199 1e-5 BLAST
internal_repeat_2 224 281 1.46e-11 PROSPERO
internal_repeat_1 233 315 2.35e-20 PROSPERO
internal_repeat_2 306 365 1.46e-11 PROSPERO
internal_repeat_1 353 435 2.35e-20 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160409
SMART Domains Protein: ENSMUSP00000138569
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
internal_repeat_2 1 37 2.8e-14 PROSPERO
internal_repeat_1 2 42 7.42e-17 PROSPERO
internal_repeat_1 38 78 7.42e-17 PROSPERO
internal_repeat_2 43 79 2.8e-14 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000160801
SMART Domains Protein: ENSMUSP00000124033
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
WD40 211 249 2.86e0 SMART
WD40 308 350 7.92e-3 SMART
WD40 394 432 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167155
AA Change: G281D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129595
Gene: ENSMUSG00000042015
AA Change: G281D

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
Blast:WD40 162 199 9e-6 BLAST
internal_repeat_1 233 260 6.23e-8 PROSPERO
internal_repeat_1 269 309 6.23e-8 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222948
Predicted Effect probably benign
Transcript: ENSMUST00000222995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223486
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein of unknown function, but which contains a WD40 domain consisting of six WD40 repeats. The WD40 domain is one of the most abundant protein domains in eukaryotes, and is found in proteins with widely varying cellular functions. However, proteins with this domain often provide a rigid scaffold for protein-protein interactions. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp704 T C 3: 9,565,193 E36G probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Wdr41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02096:Wdr41 APN 13 95017456 unclassified probably benign
IGL02813:Wdr41 APN 13 94995245 splice site probably null
gogi UTSW 13 95015217 critical splice donor site probably null
metallica UTSW 13 95015174 nonsense probably null
R0047:Wdr41 UTSW 13 95010287 missense probably damaging 1.00
R0110:Wdr41 UTSW 13 95018111 unclassified probably benign
R0243:Wdr41 UTSW 13 95017406 missense probably damaging 1.00
R0537:Wdr41 UTSW 13 94995305 splice site probably benign
R2025:Wdr41 UTSW 13 95018948 missense probably damaging 1.00
R2116:Wdr41 UTSW 13 95015029 critical splice acceptor site probably null
R3953:Wdr41 UTSW 13 94997063 missense probably damaging 1.00
R4886:Wdr41 UTSW 13 95015174 nonsense probably null
R5055:Wdr41 UTSW 13 95015217 critical splice donor site probably null
R5266:Wdr41 UTSW 13 94995251 missense probably damaging 1.00
R5276:Wdr41 UTSW 13 95017450 critical splice donor site probably null
R5738:Wdr41 UTSW 13 94978488 missense possibly damaging 0.55
R5957:Wdr41 UTSW 13 94997187 critical splice donor site probably null
R6815:Wdr41 UTSW 13 95018174 missense probably damaging 1.00
R6817:Wdr41 UTSW 13 94997304 splice site probably null
R7582:Wdr41 UTSW 13 95005767 missense probably damaging 0.97
R7832:Wdr41 UTSW 13 95015193 missense probably benign 0.06
R8003:Wdr41 UTSW 13 95013146 missense possibly damaging 0.93
R8076:Wdr41 UTSW 13 95017330 missense probably benign
R8796:Wdr41 UTSW 13 95015067 missense possibly damaging 0.94
R8919:Wdr41 UTSW 13 95015112 missense probably benign 0.00
R9715:Wdr41 UTSW 13 95008865 missense probably damaging 1.00
R9723:Wdr41 UTSW 13 95015163 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATAGGCTCTGTGCTGAC -3'
(R):5'- GTAACTCTGCGGAAGTTTTGAG -3'

Sequencing Primer
(F):5'- ACAGGCTCTGTGCTGACCATG -3'
(R):5'- GAACTTCAGCAGTACTAATCTTTCC -3'
Posted On 2018-07-23