Incidental Mutation 'R6682:Zfp9'
ID527540
Institutional Source Beutler Lab
Gene Symbol Zfp9
Ensembl Gene ENSMUSG00000072623
Gene Namezinc finger protein 9
SynonymsKrox-4, 1810048F22Rik, Zfp-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.533) question?
Stock #R6682 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location118461950-118479320 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118467241 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 47 (V47A)
Ref Sequence ENSEMBL: ENSMUSP00000123810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161170]
Predicted Effect possibly damaging
Transcript: ENSMUST00000161170
AA Change: V47A

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123810
Gene: ENSMUSG00000072623
AA Change: V47A

DomainStartEndE-ValueType
KRAB 8 68 2.26e-31 SMART
ZnF_C2H2 117 139 1.82e-3 SMART
ZnF_C2H2 144 166 4.17e-3 SMART
ZnF_C2H2 172 194 5.99e-4 SMART
ZnF_C2H2 200 222 2.79e-4 SMART
ZnF_C2H2 228 250 1.56e-2 SMART
ZnF_C2H2 256 278 6.88e-4 SMART
ZnF_C2H2 284 306 7.9e-4 SMART
ZnF_C2H2 312 334 2.75e-3 SMART
ZnF_C2H2 340 362 5.14e-3 SMART
ZnF_C2H2 368 390 1.26e-2 SMART
ZnF_C2H2 396 418 1.6e-4 SMART
ZnF_C2H2 424 446 9.08e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204066
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp704 T C 3: 9,565,193 E36G probably benign Het
Other mutations in Zfp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Zfp9 APN 6 118464475 missense probably damaging 1.00
IGL01093:Zfp9 APN 6 118465839 missense probably benign 0.14
IGL01512:Zfp9 APN 6 118467331 missense probably damaging 1.00
R0491:Zfp9 UTSW 6 118465202 missense probably damaging 0.96
R1716:Zfp9 UTSW 6 118464751 missense probably damaging 1.00
R1858:Zfp9 UTSW 6 118465060 missense probably benign 0.15
R4088:Zfp9 UTSW 6 118464769 missense probably damaging 1.00
R4490:Zfp9 UTSW 6 118465312 missense probably benign 0.06
R4627:Zfp9 UTSW 6 118464976 missense probably damaging 1.00
R4951:Zfp9 UTSW 6 118464447 missense probably damaging 1.00
R5344:Zfp9 UTSW 6 118465179 missense probably damaging 1.00
R5594:Zfp9 UTSW 6 118465039 missense probably damaging 0.98
R6198:Zfp9 UTSW 6 118477321 start codon destroyed probably null
R6986:Zfp9 UTSW 6 118464465 missense possibly damaging 0.77
R7147:Zfp9 UTSW 6 118465002 missense probably damaging 1.00
R7799:Zfp9 UTSW 6 118464882 missense probably damaging 1.00
R7921:Zfp9 UTSW 6 118465071 missense possibly damaging 0.70
R7934:Zfp9 UTSW 6 118464886 missense probably damaging 0.99
R8111:Zfp9 UTSW 6 118464600 missense probably damaging 1.00
R8369:Zfp9 UTSW 6 118464392 missense probably damaging 0.99
R8916:Zfp9 UTSW 6 118465262 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACACATTCCTTGGGAGAGAGG -3'
(R):5'- ACCTTTGTGCCTTCCTGAAG -3'

Sequencing Primer
(F):5'- CTGGTATCCCCAAACAGATG -3'
(R):5'- TCCTGAAGTCACTTCACACTGAG -3'
Posted On2018-07-23