Incidental Mutation 'R6682:Smc4'
ID 527528
Institutional Source Beutler Lab
Gene Symbol Smc4
Ensembl Gene ENSMUSG00000034349
Gene Name structural maintenance of chromosomes 4
Synonyms 2500002A22Rik, Smc4l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock # R6682 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 69004738-69034623 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 69007241 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 62 (S62R)
Ref Sequence ENSEMBL: ENSMUSP00000047872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042901] [ENSMUST00000107803] [ENSMUST00000107812] [ENSMUST00000136502] [ENSMUST00000148031] [ENSMUST00000148385] [ENSMUST00000154741] [ENSMUST00000169064] [ENSMUST00000195525]
AlphaFold Q8CG47
PDB Structure Crystal Structure of the Mouse Condensin Hinge Domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000042901
AA Change: S62R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047872
Gene: ENSMUSG00000034349
AA Change: S62R

DomainStartEndE-ValueType
PDB:1W1W|D 89 238 1e-17 PDB
Blast:AAA 104 238 3e-6 BLAST
low complexity region 408 427 N/A INTRINSIC
low complexity region 447 460 N/A INTRINSIC
low complexity region 473 482 N/A INTRINSIC
low complexity region 545 567 N/A INTRINSIC
SMC_hinge 611 726 1.12e-31 SMART
low complexity region 870 881 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
Blast:AAA 1102 1276 5e-26 BLAST
PDB:3KTA|D 1125 1276 3e-30 PDB
SCOP:d1e69a_ 1188 1263 3e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083672
Predicted Effect probably benign
Transcript: ENSMUST00000107803
SMART Domains Protein: ENSMUSP00000103433
Gene: ENSMUSG00000034349

DomainStartEndE-ValueType
Pfam:AAA_23 59 329 1.3e-12 PFAM
Pfam:AAA_21 81 199 5.2e-7 PFAM
coiled coil region 369 482 N/A INTRINSIC
coiled coil region 511 563 N/A INTRINSIC
SMC_hinge 586 701 8.6e-36 SMART
Pfam:SMC_N 738 1247 1.1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107812
SMART Domains Protein: ENSMUSP00000103442
Gene: ENSMUSG00000027778

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136448
Predicted Effect possibly damaging
Transcript: ENSMUST00000136502
AA Change: S62R

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115033
Gene: ENSMUSG00000034349
AA Change: S62R

DomainStartEndE-ValueType
Pfam:SMC_N 81 303 1.2e-42 PFAM
Pfam:AAA_23 84 336 2.6e-16 PFAM
Pfam:AAA_21 106 227 1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148031
SMART Domains Protein: ENSMUSP00000122919
Gene: ENSMUSG00000027778

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 3e-10 BLAST
WD40 95 134 9.38e-5 SMART
Blast:WD40 136 159 1e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152502
Predicted Effect probably benign
Transcript: ENSMUST00000154741
SMART Domains Protein: ENSMUSP00000118406
Gene: ENSMUSG00000027778

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 9e-10 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 209 2.12e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169064
SMART Domains Protein: ENSMUSP00000133263
Gene: ENSMUSG00000027778

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176135
Predicted Effect probably benign
Transcript: ENSMUST00000195525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192467
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the 'structural maintenance of chromosomes' (SMC) gene family. Members of this gene family play a role in two changes in chromosome structure during mitotic segregation of chromosomes- chromosome condensation and sister chromatid cohesion. The protein encoded by this gene is likely a subunit of the 13S condensin complex, which is involved in chromosome condensation. A pseudogene related to this gene is located on chromosome 2. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp704 T C 3: 9,565,193 E36G probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Smc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Smc4 APN 3 69030379 missense probably damaging 0.98
IGL00542:Smc4 APN 3 69028438 splice site probably benign
IGL01104:Smc4 APN 3 69027584 missense possibly damaging 0.95
IGL01380:Smc4 APN 3 69025828 missense probably damaging 1.00
IGL01397:Smc4 APN 3 69031544 missense probably benign
IGL02441:Smc4 APN 3 69006211 missense probably damaging 1.00
IGL02629:Smc4 APN 3 69025873 missense probably damaging 0.96
IGL03220:Smc4 APN 3 69009542 missense possibly damaging 0.67
pyrrhic UTSW 3 69027502 missense probably damaging 1.00
R0452:Smc4 UTSW 3 69008028 nonsense probably null
R0523:Smc4 UTSW 3 69025888 missense probably damaging 1.00
R0568:Smc4 UTSW 3 69022461 critical splice donor site probably null
R0571:Smc4 UTSW 3 69024289 missense probably damaging 1.00
R0602:Smc4 UTSW 3 69009538 missense probably damaging 1.00
R0925:Smc4 UTSW 3 69006215 critical splice donor site probably benign
R0963:Smc4 UTSW 3 69025926 missense probably damaging 1.00
R1540:Smc4 UTSW 3 69016772 missense probably damaging 1.00
R1755:Smc4 UTSW 3 69034108 missense probably damaging 1.00
R1920:Smc4 UTSW 3 69033068 missense probably damaging 1.00
R4226:Smc4 UTSW 3 69031467 missense probably benign 0.01
R4510:Smc4 UTSW 3 69016647 splice site probably null
R4511:Smc4 UTSW 3 69016647 splice site probably null
R4899:Smc4 UTSW 3 69031811 missense probably damaging 0.97
R4967:Smc4 UTSW 3 69018239 intron probably benign
R5096:Smc4 UTSW 3 69021279 missense probably damaging 1.00
R5101:Smc4 UTSW 3 69028512 missense probably benign 0.00
R5588:Smc4 UTSW 3 69025857 missense probably benign
R5631:Smc4 UTSW 3 69030312 missense probably benign 0.16
R5633:Smc4 UTSW 3 69008110 missense probably damaging 1.00
R6229:Smc4 UTSW 3 69030247 nonsense probably null
R6300:Smc4 UTSW 3 69027891 missense probably benign 0.00
R6554:Smc4 UTSW 3 69029515 missense probably benign 0.00
R6596:Smc4 UTSW 3 69025893 missense probably damaging 1.00
R6603:Smc4 UTSW 3 69022461 critical splice donor site probably null
R6727:Smc4 UTSW 3 69016772 missense probably damaging 1.00
R6955:Smc4 UTSW 3 69024309 missense possibly damaging 0.95
R7037:Smc4 UTSW 3 69018195 missense possibly damaging 0.67
R7051:Smc4 UTSW 3 69027502 missense probably damaging 1.00
R7454:Smc4 UTSW 3 69018124 missense probably benign
R7630:Smc4 UTSW 3 69018067 critical splice acceptor site probably benign
R7632:Smc4 UTSW 3 69018067 critical splice acceptor site probably benign
R7633:Smc4 UTSW 3 69018067 critical splice acceptor site probably benign
R7773:Smc4 UTSW 3 69016163 missense probably damaging 1.00
R7857:Smc4 UTSW 3 69033219 missense possibly damaging 0.61
R8008:Smc4 UTSW 3 69007312 missense probably damaging 0.99
R8398:Smc4 UTSW 3 69025851 missense probably damaging 1.00
R8527:Smc4 UTSW 3 69032891 critical splice donor site probably null
R8936:Smc4 UTSW 3 69018158 missense probably benign 0.21
R8998:Smc4 UTSW 3 69027561 utr 3 prime probably benign
R9267:Smc4 UTSW 3 69034453 missense probably damaging 1.00
R9440:Smc4 UTSW 3 69008122 critical splice donor site probably null
R9476:Smc4 UTSW 3 69007329 missense probably damaging 1.00
R9510:Smc4 UTSW 3 69007329 missense probably damaging 1.00
R9777:Smc4 UTSW 3 69022322 nonsense probably null
X0063:Smc4 UTSW 3 69018103 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CCCCATGAGTTTAGGATATGTTTG -3'
(R):5'- GAGTCAGGACCGTTAGAACACTG -3'

Sequencing Primer
(F):5'- GCAGATGATAGACGTTCAAC -3'
(R):5'- GGACCGTTAGAACACTGAAATATC -3'
Posted On 2018-07-23