Mutagenetix > Incidental Mutation

Incidental Mutation 'R6697:Adgb'

528624

Institutional Source

Beutler Lab

Gene Symbol

Adgb

Ensembl Gene

ENSMUSG00000050994

Gene Name

androglobin

Synonyms

9130014G24Rik

MMRRC Submission

044815-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6697 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

10211447-10348070 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 10281870 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 562 (S562*)

Ref Sequence

ENSEMBL: ENSMUSP00000146658 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045328] [ENSMUST00000132573] [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]

AlphaFold

G3UZ78

Predicted Effect

probably null
Transcript: ENSMUST00000045328
AA Change: S188*

SMART Domains

Protein: ENSMUSP00000045452
Gene: ENSMUSG00000050994
AA Change: S188*

Domain	Start	End	E-Value	Type
Blast:CysPc	11	257	1e-165	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000132573
AA Change: S586*

SMART Domains

Protein: ENSMUSP00000120422
Gene: ENSMUSG00000050994
AA Change: S586*

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000148816
AA Change: Q56K

SMART Domains

Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994
AA Change: Q56K

Domain	Start	End	E-Value	Type
Blast:CysPc	1	41	1e-19	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000172530
AA Change: S586*

SMART Domains

Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: S586*

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART
IQ	904	926	6.41e0	SMART
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1318	1335	N/A	INTRINSIC
coiled coil region	1534	1559	N/A	INTRINSIC
low complexity region	1616	1633	N/A	INTRINSIC
low complexity region	1649	1657	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000179956
AA Change: S588*

SMART Domains

Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: S588*

Domain	Start	End	E-Value	Type
CysPc	56	657	5.36e-2	SMART
IQ	906	928	6.41e0	SMART
low complexity region	1181	1192	N/A	INTRINSIC
low complexity region	1321	1338	N/A	INTRINSIC
coiled coil region	1537	1562	N/A	INTRINSIC
low complexity region	1619	1636	N/A	INTRINSIC
low complexity region	1652	1660	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000208717
AA Change: S562*

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap9	T	C	10: 127,157,989 (GRCm39)	F2S	probably benign	Het
C2cd6	ATGTGGCCTGTCTTCT	A	1: 59,090,247 (GRCm39)		probably benign	Het
Clk1	A	G	1: 58,453,781 (GRCm39)	S298P	probably benign	Het
Col7a1	T	A	9: 108,799,601 (GRCm39)	L1834Q	probably damaging	Het
Dip2c	T	C	13: 9,671,949 (GRCm39)	L1007P	probably damaging	Het
Erich3	G	T	3: 154,469,907 (GRCm39)		probably benign	Het
Fam209	A	G	2: 172,316,123 (GRCm39)	E166G	probably damaging	Het
Fbxl4	A	G	4: 22,376,599 (GRCm39)	T12A	probably benign	Het
Grid2	C	G	6: 63,908,031 (GRCm39)	R224G	possibly damaging	Het
Grin2a	T	C	16: 9,487,704 (GRCm39)	D398G	possibly damaging	Het
Hmx2	T	C	7: 131,157,663 (GRCm39)	L259P	probably damaging	Het
Macc1	A	T	12: 119,410,991 (GRCm39)	R586S	possibly damaging	Het
Map3k14	T	C	11: 103,117,890 (GRCm39)	E634G	probably benign	Het
Mettl21e	G	T	1: 44,249,327 (GRCm39)	L110I	probably damaging	Het
Mgst1	A	G	6: 138,124,751 (GRCm39)	I22V	probably damaging	Het
Muc16	T	C	9: 18,552,587 (GRCm39)	T4569A	probably benign	Het
Neu4	A	G	1: 93,952,752 (GRCm39)	K374E	probably benign	Het
Nufip1	A	G	14: 76,370,513 (GRCm39)	T405A	probably benign	Het
Rilpl2	C	T	5: 124,607,843 (GRCm39)	E126K	probably damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,229,111 (GRCm39)		probably benign	Homo
Tial1	G	T	7: 128,046,593 (GRCm39)	Q68K	possibly damaging	Het
Znrd2	A	G	19: 5,780,458 (GRCm39)	L180P	probably damaging	Het
Zp1	T	A	19: 10,892,199 (GRCm39)	I62L	probably benign	Het

Other mutations in Adgb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Adgb	APN	10	10,281,843 (GRCm39)	missense	possibly damaging	0.87
IGL01083:Adgb	APN	10	10,283,298 (GRCm39)	missense	possibly damaging	0.50
IGL03064:Adgb	APN	10	10,276,316 (GRCm39)	missense	probably benign	0.02
R0080:Adgb	UTSW	10	10,253,583 (GRCm39)	splice site	probably benign
R0084:Adgb	UTSW	10	10,272,088 (GRCm39)	missense	possibly damaging	0.74
R0112:Adgb	UTSW	10	10,282,902 (GRCm39)	splice site	probably benign
R0348:Adgb	UTSW	10	10,233,623 (GRCm39)	missense	probably benign
R0415:Adgb	UTSW	10	10,306,811 (GRCm39)	splice site	probably null
R0633:Adgb	UTSW	10	10,267,473 (GRCm39)	missense	probably benign	0.36
R1052:Adgb	UTSW	10	10,318,357 (GRCm39)	missense	probably benign	0.29
R1248:Adgb	UTSW	10	10,271,054 (GRCm39)	missense	probably damaging	0.98
R1278:Adgb	UTSW	10	10,258,572 (GRCm39)	missense	probably damaging	1.00
R1568:Adgb	UTSW	10	10,318,409 (GRCm39)	nonsense	probably null
R1647:Adgb	UTSW	10	10,271,115 (GRCm39)	missense	probably damaging	1.00
R1648:Adgb	UTSW	10	10,271,115 (GRCm39)	missense	probably damaging	1.00
R1663:Adgb	UTSW	10	10,215,419 (GRCm39)	missense	possibly damaging	0.86
R1688:Adgb	UTSW	10	10,226,061 (GRCm39)	nonsense	probably null
R1758:Adgb	UTSW	10	10,302,349 (GRCm39)	missense	probably damaging	1.00
R1772:Adgb	UTSW	10	10,258,465 (GRCm39)	splice site	probably benign
R1850:Adgb	UTSW	10	10,318,246 (GRCm39)	missense	probably damaging	1.00
R1959:Adgb	UTSW	10	10,270,993 (GRCm39)	missense	probably benign	0.02
R1980:Adgb	UTSW	10	10,309,242 (GRCm39)	missense	probably benign
R2179:Adgb	UTSW	10	10,271,018 (GRCm39)	missense	possibly damaging	0.94
R2229:Adgb	UTSW	10	10,311,795 (GRCm39)	missense	probably damaging	1.00
R2283:Adgb	UTSW	10	10,253,635 (GRCm39)	missense	probably damaging	0.99
R2870:Adgb	UTSW	10	10,307,025 (GRCm39)	critical splice donor site	probably null
R2870:Adgb	UTSW	10	10,307,025 (GRCm39)	critical splice donor site	probably null
R2875:Adgb	UTSW	10	10,298,463 (GRCm39)	missense	probably damaging	1.00
R2876:Adgb	UTSW	10	10,298,463 (GRCm39)	missense	probably damaging	1.00
R2920:Adgb	UTSW	10	10,265,987 (GRCm39)	missense	probably damaging	1.00
R2931:Adgb	UTSW	10	10,318,246 (GRCm39)	missense	possibly damaging	0.84
R3722:Adgb	UTSW	10	10,216,254 (GRCm39)	missense	probably benign	0.32
R3846:Adgb	UTSW	10	10,258,465 (GRCm39)	splice site	probably benign
R3877:Adgb	UTSW	10	10,318,227 (GRCm39)	critical splice donor site	probably null
R4210:Adgb	UTSW	10	10,283,209 (GRCm39)	missense	probably benign	0.06
R4211:Adgb	UTSW	10	10,283,209 (GRCm39)	missense	probably benign	0.06
R4333:Adgb	UTSW	10	10,318,246 (GRCm39)	missense	possibly damaging	0.84
R4448:Adgb	UTSW	10	10,266,569 (GRCm39)	missense	probably benign	0.32
R4470:Adgb	UTSW	10	10,274,695 (GRCm39)	missense	probably benign	0.02
R4624:Adgb	UTSW	10	10,278,748 (GRCm39)	missense	probably benign	0.00
R4656:Adgb	UTSW	10	10,281,050 (GRCm39)	missense	probably damaging	0.99
R4676:Adgb	UTSW	10	10,302,454 (GRCm39)	missense	probably damaging	1.00
R4792:Adgb	UTSW	10	10,274,647 (GRCm39)	missense	probably damaging	0.96
R4795:Adgb	UTSW	10	10,233,616 (GRCm39)	missense	probably benign	0.01
R4858:Adgb	UTSW	10	10,225,321 (GRCm39)	missense	probably damaging	1.00
R4985:Adgb	UTSW	10	10,276,376 (GRCm39)	missense	possibly damaging	0.69
R5057:Adgb	UTSW	10	10,233,722 (GRCm39)	missense	probably benign	0.11
R5157:Adgb	UTSW	10	10,274,710 (GRCm39)	missense	probably damaging	1.00
R5209:Adgb	UTSW	10	10,274,681 (GRCm39)	missense	possibly damaging	0.71
R5339:Adgb	UTSW	10	10,318,350 (GRCm39)	missense	probably damaging	1.00
R5376:Adgb	UTSW	10	10,222,307 (GRCm39)	missense	probably benign	0.09
R5426:Adgb	UTSW	10	10,226,004 (GRCm39)	missense	probably benign	0.14
R5516:Adgb	UTSW	10	10,306,901 (GRCm39)	missense	probably damaging	1.00
R5554:Adgb	UTSW	10	10,216,217 (GRCm39)	missense	probably damaging	0.98
R5678:Adgb	UTSW	10	10,307,070 (GRCm39)	missense	possibly damaging	0.83
R5707:Adgb	UTSW	10	10,267,501 (GRCm39)	missense	probably damaging	1.00
R5708:Adgb	UTSW	10	10,267,501 (GRCm39)	missense	probably damaging	1.00
R5891:Adgb	UTSW	10	10,253,591 (GRCm39)	nonsense	probably null
R5928:Adgb	UTSW	10	10,254,531 (GRCm39)	missense	probably damaging	1.00
R6005:Adgb	UTSW	10	10,271,096 (GRCm39)	missense	probably damaging	1.00
R6017:Adgb	UTSW	10	10,325,780 (GRCm39)	missense	probably damaging	1.00
R6049:Adgb	UTSW	10	10,253,770 (GRCm39)	missense	probably damaging	1.00
R6118:Adgb	UTSW	10	10,307,035 (GRCm39)	missense	probably damaging	1.00
R6175:Adgb	UTSW	10	10,274,687 (GRCm39)	missense	possibly damaging	0.94
R6186:Adgb	UTSW	10	10,298,502 (GRCm39)	missense	probably damaging	1.00
R6234:Adgb	UTSW	10	10,228,824 (GRCm39)	splice site	probably null
R6383:Adgb	UTSW	10	10,325,772 (GRCm39)	missense	probably damaging	1.00
R6522:Adgb	UTSW	10	10,253,636 (GRCm39)	nonsense	probably null
R6639:Adgb	UTSW	10	10,311,700 (GRCm39)	missense	possibly damaging	0.51
R6742:Adgb	UTSW	10	10,287,593 (GRCm39)	missense	probably damaging	1.00
R6745:Adgb	UTSW	10	10,265,941 (GRCm39)	missense	probably damaging	1.00
R6850:Adgb	UTSW	10	10,270,318 (GRCm39)	missense	probably benign	0.39
R7128:Adgb	UTSW	10	10,347,985 (GRCm39)	missense	probably benign	0.26
R7326:Adgb	UTSW	10	10,276,318 (GRCm39)	missense	possibly damaging	0.80
R7386:Adgb	UTSW	10	10,253,693 (GRCm39)	missense	possibly damaging	0.52
R7431:Adgb	UTSW	10	10,267,699 (GRCm39)	splice site	probably null
R7569:Adgb	UTSW	10	10,306,996 (GRCm39)	missense	probably benign
R7579:Adgb	UTSW	10	10,286,562 (GRCm39)	nonsense	probably null
R7582:Adgb	UTSW	10	10,266,565 (GRCm39)	missense	probably damaging	1.00
R7615:Adgb	UTSW	10	10,311,754 (GRCm39)	missense	probably damaging	0.96
R7692:Adgb	UTSW	10	10,287,456 (GRCm39)	critical splice donor site	probably null
R7774:Adgb	UTSW	10	10,215,404 (GRCm39)	nonsense	probably null
R7808:Adgb	UTSW	10	10,254,403 (GRCm39)	splice site	probably null
R8158:Adgb	UTSW	10	10,254,478 (GRCm39)	missense	probably benign	0.22
R8386:Adgb	UTSW	10	10,226,048 (GRCm39)	missense	probably damaging	1.00
R8746:Adgb	UTSW	10	10,281,028 (GRCm39)	critical splice donor site	probably null
R8785:Adgb	UTSW	10	10,233,710 (GRCm39)	missense	probably damaging	1.00
R9089:Adgb	UTSW	10	10,318,432 (GRCm39)	missense	probably benign	0.26
R9140:Adgb	UTSW	10	10,216,263 (GRCm39)	nonsense	probably null
R9386:Adgb	UTSW	10	10,274,708 (GRCm39)	missense	probably benign	0.00
R9777:Adgb	UTSW	10	10,283,214 (GRCm39)	missense	possibly damaging	0.74
X0003:Adgb	UTSW	10	10,270,374 (GRCm39)	missense	possibly damaging	0.76
Z1176:Adgb	UTSW	10	10,254,486 (GRCm39)	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- CAGAATCTGGTCAGATGAATGGC -3'
(R):5'- CAAGTATGTGCATGACCCATCC -3'

Sequencing Primer
(F):5'- AATCTGGTCAGATGAATGGCATTTG -3'
(R):5'- ATCCCTTCACAAACTTTAGGACTG -3'

Posted On

2018-07-24