Mutagenetix > Incidental Mutation

Incidental Mutation 'R0080:Adgb'

19642

Institutional Source

Beutler Lab

Gene Symbol

Adgb

Ensembl Gene

ENSMUSG00000050994

Gene Name

androglobin

Synonyms

9130014G24Rik

MMRRC Submission

038367-MU

Accession Numbers

MGI:3605549

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0080 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10335703-10472326 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 10377839 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146658 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]

AlphaFold

G3UZ78

Predicted Effect

probably benign
Transcript: ENSMUST00000148816

SMART Domains

Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
Blast:CysPc	1	41	1e-19	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172530

SMART Domains

Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART
IQ	904	926	6.41e0	SMART
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1318	1335	N/A	INTRINSIC
coiled coil region	1534	1559	N/A	INTRINSIC
low complexity region	1616	1633	N/A	INTRINSIC
low complexity region	1649	1657	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000179956

SMART Domains

Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
CysPc	56	657	5.36e-2	SMART
IQ	906	928	6.41e0	SMART
low complexity region	1181	1192	N/A	INTRINSIC
low complexity region	1321	1338	N/A	INTRINSIC
coiled coil region	1537	1562	N/A	INTRINSIC
low complexity region	1619	1636	N/A	INTRINSIC
low complexity region	1652	1660	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000208717

Coding Region Coverage

1x: 99.1%
3x: 97.6%
10x: 93.1%
20x: 79.7%

Validation Efficiency

88% (175/200)

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4732465J04Rik	GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC	GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC	10: 95,794,578		probably null	Het
4833427G06Rik	T	C	9: 51,101,802	T57A	probably benign	Het
Adam17	A	C	12: 21,329,048		probably benign	Het
Adcy1	T	C	11: 7,149,497		probably benign	Het
Ccdc180	A	G	4: 45,896,205	D118G	probably null	Het
Coro7	A	T	16: 4,630,464	L714Q	probably damaging	Het
D2hgdh	A	G	1: 93,826,455	Y50C	probably damaging	Het
Dsg1b	T	G	18: 20,397,367	S360A	probably damaging	Het
Ednra	T	C	8: 77,675,059	I201V	probably benign	Het
Fam173a	T	C	17: 25,791,574	I89V	probably benign	Het
Ggt6	A	G	11: 72,437,195	T136A	possibly damaging	Het
Gnb5	A	T	9: 75,314,354	E28V	possibly damaging	Het
Golgb1	T	C	16: 36,898,611	L293P	probably damaging	Het
Gpr179	A	G	11: 97,351,469	V183A	probably benign	Het
Grk6	T	C	13: 55,458,910	S474P	probably benign	Het
Hectd4	A	G	5: 121,349,372	S3477G	probably benign	Het
Irx3	T	C	8: 91,800,326	D250G	possibly damaging	Het
Jsrp1	T	G	10: 80,810,515	M70L	probably benign	Het
Kcmf1	G	T	6: 72,850,487		probably null	Het
Med23	T	C	10: 24,912,817	V1368A	probably benign	Het
Myl3	A	C	9: 110,767,929	D119A	probably damaging	Het
Ncoa6	TGC	TGCGC	2: 155,408,291		probably null	Het
Nos1	G	T	5: 117,893,878	C297F	probably damaging	Het
Oas1d	G	A	5: 120,916,892	A176T	possibly damaging	Het
Odf2l	A	T	3: 145,124,323	I19F	possibly damaging	Het
Olfr786	T	C	10: 129,437,271	I153T	possibly damaging	Het
Olfr799	G	A	10: 129,647,653	C175Y	probably benign	Het
Pfkfb2	A	T	1: 130,714,542	S5R	probably benign	Het
Pign	G	T	1: 105,552,405	A848E	probably damaging	Het
Pomgnt2	A	T	9: 121,982,260	V485E	probably damaging	Het
Ryr2	T	A	13: 11,568,475	K4764N	probably damaging	Het
Scgb1b19	A	G	7: 33,287,642	T73A	probably damaging	Het
Slc35d3	T	C	10: 19,849,198	E304G	probably damaging	Het
Snta1	A	G	2: 154,383,837	V209A	probably benign	Het
Spdye4b	A	T	5: 143,195,675	D95V	probably damaging	Het
Srek1	T	C	13: 103,743,686	T455A	unknown	Het
Tie1	T	A	4: 118,484,353	E254V	probably damaging	Het
Tigd4	A	G	3: 84,594,145	H123R	probably benign	Het
Tmem144	G	A	3: 79,839,273		probably benign	Het
Trim60	C	T	8: 65,000,599	A333T	probably damaging	Het
Vmn2r82	A	T	10: 79,396,505	R779S	probably benign	Het
Wdr91	T	C	6: 34,906,685	R132G	possibly damaging	Het
Zfp445	A	G	9: 122,852,356	V840A	probably damaging	Het

Other mutations in Adgb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Adgb	APN	10	10406099	missense	possibly damaging	0.87
IGL01083:Adgb	APN	10	10407554	missense	possibly damaging	0.50
IGL03064:Adgb	APN	10	10400572	missense	probably benign	0.02
R0084:Adgb	UTSW	10	10396344	missense	possibly damaging	0.74
R0112:Adgb	UTSW	10	10407158	splice site	probably benign
R0348:Adgb	UTSW	10	10357879	missense	probably benign
R0415:Adgb	UTSW	10	10431067	splice site	probably null
R0633:Adgb	UTSW	10	10391729	missense	probably benign	0.36
R1052:Adgb	UTSW	10	10442613	missense	probably benign	0.29
R1248:Adgb	UTSW	10	10395310	missense	probably damaging	0.98
R1278:Adgb	UTSW	10	10382828	missense	probably damaging	1.00
R1568:Adgb	UTSW	10	10442665	nonsense	probably null
R1647:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1648:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1663:Adgb	UTSW	10	10339675	missense	possibly damaging	0.86
R1688:Adgb	UTSW	10	10350317	nonsense	probably null
R1758:Adgb	UTSW	10	10426605	missense	probably damaging	1.00
R1772:Adgb	UTSW	10	10382721	splice site	probably benign
R1850:Adgb	UTSW	10	10442502	missense	probably damaging	1.00
R1959:Adgb	UTSW	10	10395249	missense	probably benign	0.02
R1980:Adgb	UTSW	10	10433498	missense	probably benign
R2179:Adgb	UTSW	10	10395274	missense	possibly damaging	0.94
R2229:Adgb	UTSW	10	10436051	missense	probably damaging	1.00
R2283:Adgb	UTSW	10	10377891	missense	probably damaging	0.99
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2875:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2876:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2920:Adgb	UTSW	10	10390243	missense	probably damaging	1.00
R2931:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R3722:Adgb	UTSW	10	10340510	missense	probably benign	0.32
R3846:Adgb	UTSW	10	10382721	splice site	probably benign
R3877:Adgb	UTSW	10	10442483	critical splice donor site	probably null
R4210:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4211:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4333:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R4448:Adgb	UTSW	10	10390825	missense	probably benign	0.32
R4470:Adgb	UTSW	10	10398951	missense	probably benign	0.02
R4624:Adgb	UTSW	10	10403004	missense	probably benign	0.00
R4656:Adgb	UTSW	10	10405306	missense	probably damaging	0.99
R4676:Adgb	UTSW	10	10426710	missense	probably damaging	1.00
R4792:Adgb	UTSW	10	10398903	missense	probably damaging	0.96
R4795:Adgb	UTSW	10	10357872	missense	probably benign	0.01
R4858:Adgb	UTSW	10	10349577	missense	probably damaging	1.00
R4985:Adgb	UTSW	10	10400632	missense	possibly damaging	0.69
R5057:Adgb	UTSW	10	10357978	missense	probably benign	0.11
R5157:Adgb	UTSW	10	10398966	missense	probably damaging	1.00
R5209:Adgb	UTSW	10	10398937	missense	possibly damaging	0.71
R5339:Adgb	UTSW	10	10442606	missense	probably damaging	1.00
R5376:Adgb	UTSW	10	10346563	missense	probably benign	0.09
R5426:Adgb	UTSW	10	10350260	missense	probably benign	0.14
R5516:Adgb	UTSW	10	10431157	missense	probably damaging	1.00
R5554:Adgb	UTSW	10	10340473	missense	probably damaging	0.98
R5678:Adgb	UTSW	10	10431326	missense	possibly damaging	0.83
R5707:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5708:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5891:Adgb	UTSW	10	10377847	nonsense	probably null
R5928:Adgb	UTSW	10	10378787	missense	probably damaging	1.00
R6005:Adgb	UTSW	10	10395352	missense	probably damaging	1.00
R6017:Adgb	UTSW	10	10450036	missense	probably damaging	1.00
R6049:Adgb	UTSW	10	10378026	missense	probably damaging	1.00
R6118:Adgb	UTSW	10	10431291	missense	probably damaging	1.00
R6175:Adgb	UTSW	10	10398943	missense	possibly damaging	0.94
R6186:Adgb	UTSW	10	10422758	missense	probably damaging	1.00
R6234:Adgb	UTSW	10	10353080	splice site	probably null
R6383:Adgb	UTSW	10	10450028	missense	probably damaging	1.00
R6522:Adgb	UTSW	10	10377892	nonsense	probably null
R6639:Adgb	UTSW	10	10435956	missense	possibly damaging	0.51
R6697:Adgb	UTSW	10	10406126	nonsense	probably null
R6742:Adgb	UTSW	10	10411849	missense	probably damaging	1.00
R6745:Adgb	UTSW	10	10390197	missense	probably damaging	1.00
R6850:Adgb	UTSW	10	10394574	missense	probably benign	0.39
R7128:Adgb	UTSW	10	10472241	missense	probably benign	0.26
R7326:Adgb	UTSW	10	10400574	missense	possibly damaging	0.80
R7386:Adgb	UTSW	10	10377949	missense	possibly damaging	0.52
R7431:Adgb	UTSW	10	10391955	splice site	probably null
R7569:Adgb	UTSW	10	10431252	missense	probably benign
R7579:Adgb	UTSW	10	10410818	nonsense	probably null
R7582:Adgb	UTSW	10	10390821	missense	probably damaging	1.00
R7615:Adgb	UTSW	10	10436010	missense	probably damaging	0.96
R7692:Adgb	UTSW	10	10411712	critical splice donor site	probably null
R7774:Adgb	UTSW	10	10339660	nonsense	probably null
R7808:Adgb	UTSW	10	10378659	splice site	probably null
R8158:Adgb	UTSW	10	10378734	missense	probably benign	0.22
R8386:Adgb	UTSW	10	10350304	missense	probably damaging	1.00
R8746:Adgb	UTSW	10	10405284	critical splice donor site	probably null
R8785:Adgb	UTSW	10	10357966	missense	probably damaging	1.00
R9089:Adgb	UTSW	10	10442688	missense	probably benign	0.26
R9140:Adgb	UTSW	10	10340519	nonsense	probably null
R9386:Adgb	UTSW	10	10398964	missense	probably benign	0.00
R9777:Adgb	UTSW	10	10407470	missense	possibly damaging	0.74
X0003:Adgb	UTSW	10	10394630	missense	possibly damaging	0.76
Z1176:Adgb	UTSW	10	10378742	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- CGCAGTTATTGCCCAGTCACTGTTTAC -3'
(R):5'- CCTAAGAAAGATCCAGAAGTGCTGACC -3'

Sequencing Primer
(F):5'- tctttctccgtctttctctacc -3'
(R):5'- CTGACCAAGAAAAAGTCTGGC -3'

Protein Function and Prediction

Androglobin (ADGB) has an N-terminal calpain-like protease domain (amino acids 56-657, SMART; amino acids 70-402, UniProt), a globin domain with a calmodulin-binding IQ motif (amino acids 906-928, SMART), a C-terminal coiled-coil region (amino acids (1537-1567, SMART), and putative overlapping nuclear localization and endoplasmic reticulum membrane retention signals at its C-terminus (1). The calpain domain is predicted to be nonfunctional (1). The globin domain exhibits an absorption spectrum characteristic of hexacoordination of the heme iron atom (1).The ADGB globin domain is split into two parts that are divided by the IQ motif (1). The globin domain exhibits a relatively uncommon, but naturally occurring circular permutation of α-helices (1). Initial tandem duplication of the globin domain, followed by trimming of redundant duplicate regions from the N- and C-termini are predicted to lead to the circular permutation; protein function is not changed (2). Hoogewijs et al. propose several putative functions of the ADGB globin domain including a function in redox-regulated signaling or as a mediator of O₂ level-dependent protein activity (1). The coiled-coil motif is predicted to function in protein dimerization (1).

Expression/Localization

Adgb expression was high in mouse and human testis, with lower expression in the lung, heart, and brain (1). Little to no expression was detected in other tissues examined (1). Adgb expression in the testis is associated with postmeiotic stages of spermatogenesis (approximately postnatal day (P) 25 through adulthood) (1). Adgb expression in testis-derived cell lines corresponding to Leydig cells, Sertoli cells, spermatogonia, and spermatogyctes was very low (1). Within the testis, Adgb is expressed in the lumen of the seminiferous tubes (1). Expression of Adgb is higher in fertile males compared to infertile males (1).

Background

Globin proteins are respiratory proteins that have diverse functions including oxygen sensing, storage, sulfide and oxygen transport, peroxidase activity, reaction with nitric oxide and free radicals, and detoxification (3). ADGB is proposed to function in late phases of spermatogenesis (1). The members of the globin superfamily function in several types of cancers (4-6). ADGB has an oncogene role in glioma (7). Knockdown of ADGB expression resulted in inhibition of glioma cell line proliferation as well as increased apoptosis (7). ADGB knockdown also altered the phosphorylation levels of STAT3, Akt, and ERK1/2 as well as the levels of cleaved caspase-3 and decreased levels of cyclin D1 and Bcl-2 (7). The function of ADGB is unknown.

References

1. Hoogewijs, D., Ebner, B., Germani, F., Hoffmann, F. G., Fabrizius, A., Moens, L., Burmester, T., Dewilde, S., Storz, J. F., Vinogradov, S. N., and Hankeln, T. (2012) Androglobin: A Chimeric Globin in Metazoans that is Preferentially Expressed in Mammalian Testes. Mol Biol Evol. 29, 1105-1114.

2. Vogel, C., and Morea, V. (2006) Duplication, Divergence and Formation of Novel Protein Topologies. Bioessays. 28, 973-978.

3. Vinogradov, S. N., and Moens, L. (2008) Diversity of Globin Function: Enzymatic, Transport, Storage, and Sensing. J Biol Chem. 283, 8773-8777.

4. Emara, M., Turner, A. R., and Allalunis-Turner, J. (2010) Hypoxic Regulation of Cytoglobin and Neuroglobin Expression in Human Normal and Tumor Tissues. Cancer Cell Int. 10, 33-2867-10-33.

5. Oleksiewicz, U., Daskoulidou, N., Liloglou, T., Tasopoulou, K., Bryan, J., Gosney, J. R., Field, J. K., and Xinarianos, G. (2011) Neuroglobin and Myoglobin in Non-Small Cell Lung Cancer: Expression, Regulation and Prognosis. Lung Cancer. 74, 411-418.

6. Zhang, J., Lan, S. J., Liu, Q. R., Liu, J. M., and Chen, X. Q. (2013) Neuroglobin, a Novel Intracellular Hexa-Coordinated Globin, Functions as a Tumor Suppressor in Hepatocellular Carcinoma Via Raf/MAPK/Erk. Mol Pharmacol. 83, 1109-1119.

7. Huang, B., Lu, Y. S., Li, X., Zhu, Z. C., Li, K., Liu, J. W., Zheng, J., and Hu, Z. L. (2014) Androglobin Knockdown Inhibits Growth of Glioma Cell Lines. Int J Clin Exp Pathol. 7, 2179-2184.

Posted On

2013-04-11

Science Writer

Anne Murray