Incidental Mutation 'R6722:Olfr1318'
ID529617
Institutional Source Beutler Lab
Gene Symbol Olfr1318
Ensembl Gene ENSMUSG00000049758
Gene Nameolfactory receptor 1318
SynonymsMOR245-16, GA_x6K02T2Q125-73202172-73203134
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6722 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location112154198-112159157 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112156882 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 310 (N310K)
Ref Sequence ENSEMBL: ENSMUSP00000151164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058176] [ENSMUST00000214063] [ENSMUST00000217533]
Predicted Effect probably benign
Transcript: ENSMUST00000058176
AA Change: N310K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051938
Gene: ENSMUSG00000049758
AA Change: N310K

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 2.4e-39 PFAM
Pfam:7tm_1 41 287 1.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214063
AA Change: N310K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216873
Predicted Effect probably benign
Transcript: ENSMUST00000217533
AA Change: N310K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 T G 12: 81,421,454 D131A probably damaging Het
Ank3 T C 10: 69,990,244 probably benign Het
Arntl2 T A 6: 146,818,900 D187E probably damaging Het
Atp1a4 T C 1: 172,258,050 probably benign Het
BC005561 T A 5: 104,520,279 M889K probably damaging Het
Ccdc162 T C 10: 41,644,641 N673S probably benign Het
Cd84 G A 1: 171,872,777 V154M probably damaging Het
Celsr1 C A 15: 85,905,914 probably null Het
Cfap57 A C 4: 118,584,717 L718R probably damaging Het
Cntnap5b G A 1: 100,478,486 V803M probably damaging Het
Col6a2 C T 10: 76,614,558 V180I probably damaging Het
Coq4 A T 2: 29,788,285 probably benign Het
Cyp2a4 A G 7: 26,313,558 T389A probably benign Het
Dennd1c T C 17: 57,066,802 D587G probably benign Het
Dnaja4 A G 9: 54,699,754 D9G probably damaging Het
Gatsl2 T C 5: 134,135,619 S140P probably benign Het
Gm11808 A G 4: 3,973,386 Y59H probably benign Het
Hes2 T G 4: 152,160,377 L101R probably damaging Het
Icam2 A G 11: 106,382,481 S2P probably damaging Het
Krt31 A G 11: 100,048,428 L221P probably damaging Het
Lipm A T 19: 34,121,265 N380Y probably benign Het
Lrp2bp G A 8: 46,020,563 probably null Het
Mbd2 T A 18: 70,580,748 M216K probably damaging Het
Mrps33 T C 6: 39,805,665 probably benign Het
Nbeal2 T C 9: 110,632,992 D1459G probably damaging Het
Ncapd3 T C 9: 27,087,556 S1281P probably benign Het
Nt5c1b T A 12: 10,372,874 Y56N possibly damaging Het
Nthl1 A G 17: 24,634,034 K71E probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pde4a G A 9: 21,211,225 A806T probably damaging Het
Pde4d C A 13: 109,632,898 S40* probably null Het
Pde4dip G A 3: 97,718,239 R1348* probably null Het
Pdx1 C T 5: 147,270,500 P88S probably damaging Het
Pnisr T A 4: 21,859,165 V120D probably damaging Het
Prss51 G T 14: 64,095,059 C65F probably damaging Het
Pus10 G A 11: 23,702,975 E195K possibly damaging Het
Pzp T A 6: 128,487,954 Q1319L probably damaging Het
Rbpms G T 8: 33,834,393 T101K probably damaging Het
Rundc3a A G 11: 102,399,949 N281S possibly damaging Het
Scml4 C T 10: 42,860,732 probably benign Het
Sez6 T C 11: 77,953,702 V117A probably damaging Het
Sgsm2 A C 11: 74,865,424 C366W probably damaging Het
Slc12a4 T C 8: 105,944,250 probably null Het
Smg5 C T 3: 88,353,025 R641C probably damaging Het
Stxbp3 A G 3: 108,816,446 Y150H probably benign Het
Tkt T C 14: 30,569,084 F351S probably damaging Het
Tln1 A G 4: 43,547,618 L781P probably damaging Het
Triobp G A 15: 79,001,565 E1823K probably damaging Het
Ttll4 T C 1: 74,681,789 V538A possibly damaging Het
Vmn1r61 T A 7: 5,610,688 N209I possibly damaging Het
Wdr75 T A 1: 45,805,352 probably null Het
Zfp985 T C 4: 147,583,071 V132A probably benign Het
Zswim3 T A 2: 164,820,624 probably null Het
Other mutations in Olfr1318
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Olfr1318 APN 2 112156067 missense probably benign
IGL00923:Olfr1318 APN 2 112156777 missense possibly damaging 0.75
IGL02800:Olfr1318 APN 2 112156244 missense possibly damaging 0.95
R0012:Olfr1318 UTSW 2 112156826 missense possibly damaging 0.84
R1614:Olfr1318 UTSW 2 112156517 missense probably damaging 1.00
R1989:Olfr1318 UTSW 2 112156377 missense probably benign 0.00
R2428:Olfr1318 UTSW 2 112156442 missense probably benign 0.03
R2963:Olfr1318 UTSW 2 112156459 nonsense probably null
R4868:Olfr1318 UTSW 2 112156571 missense probably damaging 0.99
R4960:Olfr1318 UTSW 2 112156352 missense probably benign 0.00
R5121:Olfr1318 UTSW 2 112156286 missense possibly damaging 0.47
R6218:Olfr1318 UTSW 2 112156356 missense probably damaging 0.99
R6294:Olfr1318 UTSW 2 112156019 missense probably benign
R6350:Olfr1318 UTSW 2 112156197 missense probably damaging 0.99
R6515:Olfr1318 UTSW 2 112156365 missense probably benign 0.00
R6829:Olfr1318 UTSW 2 112155794 intron probably benign
R7186:Olfr1318 UTSW 2 112156162 missense probably damaging 1.00
R7206:Olfr1318 UTSW 2 112156459 missense probably damaging 1.00
R7444:Olfr1318 UTSW 2 112156715 missense probably damaging 1.00
R8293:Olfr1318 UTSW 2 112156253 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CTCAGGTGCTTCCTCCAAGG -3'
(R):5'- CTTCACTATCAAATTAAAGGCCTCATC -3'

Sequencing Primer
(F):5'- AAGGCCCTCTCCACTCTCTCAG -3'
(R):5'- GACATAAATTTTACACACACGTACAG -3'
Posted On2018-08-01