Incidental Mutation 'R6722:Dennd1c'
ID529661
Institutional Source Beutler Lab
Gene Symbol Dennd1c
Ensembl Gene ENSMUSG00000002668
Gene NameDENN/MADD domain containing 1C
Synonyms4432409M07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6722 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location57066056-57078510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57066802 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 587 (D587G)
Ref Sequence ENSEMBL: ENSMUSP00000011623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011623] [ENSMUST00000071826] [ENSMUST00000097299] [ENSMUST00000163628] [ENSMUST00000163763] [ENSMUST00000169543]
Predicted Effect probably benign
Transcript: ENSMUST00000011623
AA Change: D587G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000011623
Gene: ENSMUSG00000002668
AA Change: D587G

DomainStartEndE-ValueType
uDENN 9 89 1.18e-22 SMART
DENN 90 293 3.95e-74 SMART
low complexity region 312 318 N/A INTRINSIC
dDENN 324 391 2.39e-18 SMART
low complexity region 560 579 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071826
SMART Domains Protein: ENSMUSP00000071729
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097299
SMART Domains Protein: ENSMUSP00000094902
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163628
SMART Domains Protein: ENSMUSP00000126402
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCOP:d1fwxa1 30 52 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163763
SMART Domains Protein: ENSMUSP00000132502
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169543
SMART Domains Protein: ENSMUSP00000125760
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1C, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 T G 12: 81,421,454 D131A probably damaging Het
Ank3 T C 10: 69,990,244 probably benign Het
Arntl2 T A 6: 146,818,900 D187E probably damaging Het
Atp1a4 T C 1: 172,258,050 probably benign Het
BC005561 T A 5: 104,520,279 M889K probably damaging Het
Ccdc162 T C 10: 41,644,641 N673S probably benign Het
Cd84 G A 1: 171,872,777 V154M probably damaging Het
Celsr1 C A 15: 85,905,914 probably null Het
Cfap57 A C 4: 118,584,717 L718R probably damaging Het
Cntnap5b G A 1: 100,478,486 V803M probably damaging Het
Col6a2 C T 10: 76,614,558 V180I probably damaging Het
Coq4 A T 2: 29,788,285 probably benign Het
Cyp2a4 A G 7: 26,313,558 T389A probably benign Het
Dnaja4 A G 9: 54,699,754 D9G probably damaging Het
Gatsl2 T C 5: 134,135,619 S140P probably benign Het
Gm11808 A G 4: 3,973,386 Y59H probably benign Het
Hes2 T G 4: 152,160,377 L101R probably damaging Het
Icam2 A G 11: 106,382,481 S2P probably damaging Het
Krt31 A G 11: 100,048,428 L221P probably damaging Het
Lipm A T 19: 34,121,265 N380Y probably benign Het
Lrp2bp G A 8: 46,020,563 probably null Het
Mbd2 T A 18: 70,580,748 M216K probably damaging Het
Mrps33 T C 6: 39,805,665 probably benign Het
Nbeal2 T C 9: 110,632,992 D1459G probably damaging Het
Ncapd3 T C 9: 27,087,556 S1281P probably benign Het
Nt5c1b T A 12: 10,372,874 Y56N possibly damaging Het
Nthl1 A G 17: 24,634,034 K71E probably benign Het
Olfr1318 T A 2: 112,156,882 N310K probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pde4a G A 9: 21,211,225 A806T probably damaging Het
Pde4d C A 13: 109,632,898 S40* probably null Het
Pde4dip G A 3: 97,718,239 R1348* probably null Het
Pdx1 C T 5: 147,270,500 P88S probably damaging Het
Pnisr T A 4: 21,859,165 V120D probably damaging Het
Prss51 G T 14: 64,095,059 C65F probably damaging Het
Pus10 G A 11: 23,702,975 E195K possibly damaging Het
Pzp T A 6: 128,487,954 Q1319L probably damaging Het
Rbpms G T 8: 33,834,393 T101K probably damaging Het
Rundc3a A G 11: 102,399,949 N281S possibly damaging Het
Scml4 C T 10: 42,860,732 probably benign Het
Sez6 T C 11: 77,953,702 V117A probably damaging Het
Sgsm2 A C 11: 74,865,424 C366W probably damaging Het
Slc12a4 T C 8: 105,944,250 probably null Het
Smg5 C T 3: 88,353,025 R641C probably damaging Het
Stxbp3 A G 3: 108,816,446 Y150H probably benign Het
Tkt T C 14: 30,569,084 F351S probably damaging Het
Tln1 A G 4: 43,547,618 L781P probably damaging Het
Triobp G A 15: 79,001,565 E1823K probably damaging Het
Ttll4 T C 1: 74,681,789 V538A possibly damaging Het
Vmn1r61 T A 7: 5,610,688 N209I possibly damaging Het
Wdr75 T A 1: 45,805,352 probably null Het
Zfp985 T C 4: 147,583,071 V132A probably benign Het
Zswim3 T A 2: 164,820,624 probably null Het
Other mutations in Dennd1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Dennd1c APN 17 57066839 missense probably damaging 0.99
IGL02729:Dennd1c APN 17 57066637 missense probably benign 0.34
IGL03185:Dennd1c APN 17 57066803 missense probably benign 0.00
R0067:Dennd1c UTSW 17 57075465 missense probably damaging 1.00
R0067:Dennd1c UTSW 17 57075465 missense probably damaging 1.00
R0288:Dennd1c UTSW 17 57076870 splice site probably null
R0380:Dennd1c UTSW 17 57073822 missense probably damaging 1.00
R0381:Dennd1c UTSW 17 57073822 missense probably damaging 1.00
R0389:Dennd1c UTSW 17 57067649 missense probably benign 0.02
R1528:Dennd1c UTSW 17 57066935 missense probably benign
R1892:Dennd1c UTSW 17 57067083 missense probably benign 0.00
R1936:Dennd1c UTSW 17 57073889 splice site probably benign
R2216:Dennd1c UTSW 17 57074492 critical splice donor site probably null
R3021:Dennd1c UTSW 17 57074180 critical splice acceptor site probably null
R3160:Dennd1c UTSW 17 57066562 missense possibly damaging 0.87
R3162:Dennd1c UTSW 17 57066562 missense possibly damaging 0.87
R3162:Dennd1c UTSW 17 57066562 missense possibly damaging 0.87
R4133:Dennd1c UTSW 17 57076980 missense possibly damaging 0.53
R4831:Dennd1c UTSW 17 57066428 nonsense probably null
R4987:Dennd1c UTSW 17 57073852 missense probably damaging 0.98
R5417:Dennd1c UTSW 17 57066755 frame shift probably null
R5418:Dennd1c UTSW 17 57066755 frame shift probably null
R6241:Dennd1c UTSW 17 57066272 missense probably benign 0.00
R6259:Dennd1c UTSW 17 57067104 missense probably damaging 1.00
R7099:Dennd1c UTSW 17 57067915 critical splice donor site probably null
R7491:Dennd1c UTSW 17 57072379 missense probably damaging 1.00
R7595:Dennd1c UTSW 17 57071633 missense probably damaging 1.00
R8081:Dennd1c UTSW 17 57074139 missense possibly damaging 0.94
R8198:Dennd1c UTSW 17 57066460 missense possibly damaging 0.84
Z1177:Dennd1c UTSW 17 57074330 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCCAGTTGCCATGGTAACCC -3'
(R):5'- CAACTGATGAGGGGTGTCTTCTAG -3'

Sequencing Primer
(F):5'- CCACTGGGATGTCAGGCTG -3'
(R):5'- GTCTTCTAGACTCCGGAGACAAAG -3'
Posted On2018-08-01