Mutagenetix > Incidental Mutations

Incidental Mutation 'R6910:Map3k8'

538994

Institutional Source

Beutler Lab

Gene Symbol

Map3k8

Ensembl Gene

ENSMUSG00000024235

Gene Name

mitogen-activated protein kinase kinase kinase 8

Synonyms

Tpl2, Tpl-2, c-COT, Cot, Cot/Tpl2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6910 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4331327-4353015 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4340801 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 171 (I171T)

Ref Sequence

ENSEMBL: ENSMUSP00000025078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025078] [ENSMUST00000173930]

Predicted Effect

probably benign
Transcript: ENSMUST00000025078
AA Change: I171T

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000025078
Gene: ENSMUSG00000024235
AA Change: I171T

Domain	Start	End	E-Value	Type
Pfam:Pkinase	137	388	1.1e-47	PFAM
Pfam:Pkinase_Tyr	139	386	4.6e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173930

SMART Domains

Protein: ENSMUSP00000133469
Gene: ENSMUSG00000024235

Domain	Start	End	E-Value	Type
SCOP:d1phk__	146	169	2e-4	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an oncogene that encodes a member of the serine/threonine protein kinase family. The encoded protein localizes to the cytoplasm and can activate both the MAP kinase and JNK kinase pathways. This protein was shown to activate IkappaB kinases, and thus induce the nuclear production of NF-kappaB. This protein was also found to promote the production of TNF-alpha and IL-2 during T lymphocyte activation. This gene may also utilize a downstream in-frame translation start codon, and thus produce an isoform containing a shorter N-terminus. The shorter isoform has been shown to display weaker transforming activity. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice resist endotoxic shock. Their MHC II expression is enhanced. Macrophages' TNF-alpha response to viruses and to all TLR ligands is impaired. Macrophage and T-cell secretion of other cytokines in response to various TLR ligands or OVA is aberrant. Anti-OVA Ig classes are abnormally skewed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,620,447	V151A	probably damaging	Het
Cfap54	A	G	10: 92,836,512	S2899P	probably benign	Het
Chil5	A	G	3: 106,019,661	W82R	probably damaging	Het
Dennd3	A	G	15: 73,555,116	T781A	probably benign	Het
Epha2	A	G	4: 141,321,513	D597G	probably damaging	Het
Gcn1l1	A	G	5: 115,606,538	T1598A	probably benign	Het
Glp2r	A	G	11: 67,730,671	F162S	probably benign	Het
Gm10130	A	T	2: 150,324,067	Q56L	probably benign	Het
Gm17655	T	A	5: 110,047,173	R248*	probably null	Het
Gm9268	T	C	7: 43,024,051	F178L	probably benign	Het
Gnptab	G	A	10: 88,431,396	G450S	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Hapln2	A	G	3: 88,023,828	Y127H	probably damaging	Het
Hdac4	G	T	1: 91,982,153	T463K	probably damaging	Het
Ift80	A	C	3: 68,927,735	S458A	probably benign	Het
Lama1	A	G	17: 67,791,464	D1846G	possibly damaging	Het
Micu1	A	G	10: 59,740,667	E115G	probably damaging	Het
Mrpl39	A	G	16: 84,735,192	V9A	unknown	Het
Ncoa7	T	G	10: 30,694,121	I281L	possibly damaging	Het
Nms	A	G	1: 38,941,895	E54G	probably benign	Het
Nrip1	G	A	16: 76,294,417	A84V	probably damaging	Het
Olfr1331	T	A	4: 118,869,138	M119K	probably damaging	Het
Olfr743	G	A	14: 50,533,873	V154M	probably benign	Het
Pcdhga10	T	A	18: 37,748,232	S349T	probably damaging	Het
R3hcc1	G	A	14: 69,697,575	P454L	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Ryr3	T	C	2: 112,958,175	D170G	probably damaging	Het
Scp2	C	A	4: 108,105,086	G81C	probably damaging	Het
Sez6	A	G	11: 77,953,869	T173A	possibly damaging	Het
Syne1	T	C	10: 5,048,887	H8142R	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tnfrsf11a	A	G	1: 105,844,546	T520A	probably damaging	Het
Tpm1	A	G	9: 67,031,974	S170P	probably damaging	Het
Try5	T	C	6: 41,311,799	D54G	possibly damaging	Het
Zan	T	C	5: 137,419,080	E3041G	unknown	Het
Zfp616	A	T	11: 74,085,002	H699L	probably damaging	Het

Other mutations in Map3k8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02458:Map3k8	APN	18	4334660	missense	probably damaging	1.00
IGL02483:Map3k8	APN	18	4349318	utr 5 prime	probably benign
IGL03174:Map3k8	APN	18	4349247	missense	probably damaging	1.00
Flojo	UTSW	18	4339548	missense	possibly damaging	0.95
gnostic_gospel	UTSW	18	4333965	missense	probably damaging	1.00
juicy	UTSW	18	4339552	missense	probably damaging	0.99
Sluggish	UTSW	18	4339608	splice site	probably benign
R0304:Map3k8	UTSW	18	4339552	missense	probably damaging	0.99
R0569:Map3k8	UTSW	18	4349162	missense	probably benign	0.00
R1748:Map3k8	UTSW	18	4334766	missense	probably damaging	1.00
R1793:Map3k8	UTSW	18	4332389	nonsense	probably null
R2310:Map3k8	UTSW	18	4349001	missense	probably benign
R3625:Map3k8	UTSW	18	4333965	missense	probably damaging	1.00
R4786:Map3k8	UTSW	18	4340647	nonsense	probably null
R4921:Map3k8	UTSW	18	4349124	missense	possibly damaging	0.92
R4930:Map3k8	UTSW	18	4349215	nonsense	probably null
R4934:Map3k8	UTSW	18	4339548	missense	possibly damaging	0.95
R4956:Map3k8	UTSW	18	4339530	missense	probably benign	0.00
R5241:Map3k8	UTSW	18	4340750	missense	probably damaging	0.98
R5549:Map3k8	UTSW	18	4340762	missense	probably damaging	0.98
R6317:Map3k8	UTSW	18	4348979	critical splice donor site	probably null
R6326:Map3k8	UTSW	18	4340651	missense	probably damaging	1.00
R7010:Map3k8	UTSW	18	4334060	missense	probably damaging	1.00
R7247:Map3k8	UTSW	18	4334036	missense	probably damaging	1.00
R7300:Map3k8	UTSW	18	4349076	missense	probably damaging	0.98
R7348:Map3k8	UTSW	18	4340561	missense	probably damaging	1.00
R7903:Map3k8	UTSW	18	4349162	missense	probably benign	0.00
R8302:Map3k8	UTSW	18	4334064	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AATTCTCTCATGGGCCCACAAC -3'
(R):5'- AGTGAGGTTTTCCCTACCCTG -3'

Sequencing Primer
(F):5'- ACTCTCCAGTTTCTCCAGAACAG -3'
(R):5'- ATGTCATGATGTAGAAGTGAGTCTG -3'

Posted On

2018-11-06