Incidental Mutation 'R6951:Nup85'
ID541280
Institutional Source Beutler Lab
Gene Symbol Nup85
Ensembl Gene ENSMUSG00000020739
Gene Namenucleoporin 85
Synonymsfrount, Pcnt1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6951 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location115564434-115583985 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115582955 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 565 (T565I)
Ref Sequence ENSEMBL: ENSMUSP00000021085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019135] [ENSMUST00000021085] [ENSMUST00000106508] [ENSMUST00000140986] [ENSMUST00000144473] [ENSMUST00000156173]
Predicted Effect probably benign
Transcript: ENSMUST00000019135
SMART Domains Protein: ENSMUSP00000019135
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 222 299 1.7e-20 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Alpha_adaptinC2 586 710 6.09e-43 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000021085
AA Change: T565I

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021085
Gene: ENSMUSG00000020739
AA Change: T565I

DomainStartEndE-ValueType
Pfam:Nucleopor_Nup85 53 606 1.2e-181 PFAM
low complexity region 635 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106508
SMART Domains Protein: ENSMUSP00000102117
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 1.3e-32 PFAM
low complexity region 377 393 N/A INTRINSIC
low complexity region 405 420 N/A INTRINSIC
low complexity region 454 476 N/A INTRINSIC
Alpha_adaptinC2 508 632 6.09e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140986
SMART Domains Protein: ENSMUSP00000117333
Gene: ENSMUSG00000020739

DomainStartEndE-ValueType
Pfam:Nucleopor_Nup85 21 280 5.9e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144473
SMART Domains Protein: ENSMUSP00000116069
Gene: ENSMUSG00000020739

DomainStartEndE-ValueType
Pfam:Nucleopor_Nup85 1 170 3e-56 PFAM
Pfam:Nucleopor_Nup85 168 274 1.1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156173
SMART Domains Protein: ENSMUSP00000138597
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 7.3e-32 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein component of the Nup107-160 subunit of the nuclear pore complex. Nuclear pore complexes are embedded in the nuclear envelope and promote bidirectional transport of macromolecules between the cytoplasm and nucleus. The encoded protein can also bind to the C-terminus of chemokine (C-C motif) receptor 2 (CCR2) and promote chemotaxis of monocytes, thereby participating in the inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A G 4: 58,853,114 probably null Het
Ankrd34a A G 3: 96,598,422 N314S possibly damaging Het
Arhgef3 A T 14: 27,144,018 probably benign Het
Bmp1 T C 14: 70,508,858 R114G probably benign Het
Cenpf A G 1: 189,653,792 L2097P probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnase2a A T 8: 84,909,625 N130I possibly damaging Het
Dpp10 C T 1: 123,341,650 V677M possibly damaging Het
Dsp G A 13: 38,167,646 C147Y possibly damaging Het
Esyt2 A G 12: 116,324,130 T223A probably benign Het
Fndc5 G A 4: 129,138,780 V59I possibly damaging Het
Fsip2 A G 2: 82,981,949 T2871A possibly damaging Het
H2-Eb1 A T 17: 34,309,857 R121* probably null Het
Hydin A G 8: 110,398,125 I589V probably benign Het
Kitl A G 10: 100,051,852 I48V probably damaging Het
Large1 A G 8: 73,116,419 S159P probably damaging Het
Lrba T C 3: 86,745,873 L2570P probably benign Het
Mag G A 7: 30,911,433 T128I possibly damaging Het
Mb21d1 A G 9: 78,442,558 V174A probably damaging Het
Mkrn3 G T 7: 62,419,133 D303E possibly damaging Het
Myo9a A G 9: 59,894,768 D1951G probably damaging Het
Olfr1077-ps1 T C 2: 86,525,649 H176R probably damaging Het
Olfr1156 T C 2: 87,949,979 I85V possibly damaging Het
Olfr902 A G 9: 38,448,938 D22G probably benign Het
Olfr915 A G 9: 38,646,874 S217P probably damaging Het
Pdzrn3 A T 6: 101,154,192 probably null Het
Picalm T A 7: 90,191,375 N434K probably damaging Het
Platr25 A C 13: 62,705,748 D77E probably benign Het
Prr22 A T 17: 56,772,028 R394* probably null Het
Psg23 A T 7: 18,614,711 L57Q probably damaging Het
Rap1gap2 G A 11: 74,484,948 S44L possibly damaging Het
Rffl A G 11: 82,845,750 probably null Het
Stox2 G A 8: 47,203,132 T103I probably damaging Het
Swt1 T C 1: 151,397,268 N543S possibly damaging Het
Tep1 C T 14: 50,833,913 probably null Het
Tln2 A G 9: 67,258,485 Y1023H probably damaging Het
Tssk5 C A 15: 76,372,896 R262L possibly damaging Het
Ttn C T 2: 76,880,642 probably benign Het
Ubtfl1 A T 9: 18,409,577 I134F probably benign Het
Unc80 T C 1: 66,648,511 F2351S possibly damaging Het
Vps13a A T 19: 16,723,740 D688E probably benign Het
Other mutations in Nup85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00550:Nup85 APN 11 115581756 missense probably damaging 1.00
IGL01538:Nup85 APN 11 115569714 missense possibly damaging 0.81
IGL01775:Nup85 APN 11 115580767 missense probably damaging 1.00
IGL02170:Nup85 APN 11 115577931 missense probably damaging 0.97
IGL02456:Nup85 APN 11 115581865 unclassified probably benign
IGL02888:Nup85 APN 11 115578800 missense possibly damaging 0.89
IGL03210:Nup85 APN 11 115566636 missense probably benign 0.11
PIT4403001:Nup85 UTSW 11 115581820 missense probably damaging 0.98
R0195:Nup85 UTSW 11 115564531 start codon destroyed probably null 1.00
R0394:Nup85 UTSW 11 115564531 start codon destroyed probably null 1.00
R0639:Nup85 UTSW 11 115564531 start codon destroyed probably null 1.00
R0883:Nup85 UTSW 11 115568370 nonsense probably null
R1567:Nup85 UTSW 11 115568398 missense possibly damaging 0.83
R1774:Nup85 UTSW 11 115582945 missense probably benign 0.01
R1846:Nup85 UTSW 11 115568413 missense probably benign 0.11
R1851:Nup85 UTSW 11 115581817 missense probably damaging 1.00
R2084:Nup85 UTSW 11 115568691 missense possibly damaging 0.71
R4766:Nup85 UTSW 11 115577925 splice site probably null
R5748:Nup85 UTSW 11 115580512 missense probably damaging 1.00
R6362:Nup85 UTSW 11 115583734 missense probably damaging 0.98
R6906:Nup85 UTSW 11 115580943 missense probably damaging 1.00
R7835:Nup85 UTSW 11 115570071 missense probably benign 0.35
R8125:Nup85 UTSW 11 115578237 frame shift probably null
R8151:Nup85 UTSW 11 115577933 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TACTGACACTTCCCCAAGGC -3'
(R):5'- CTTAGGCGTAAATGAGCTTCTG -3'

Sequencing Primer
(F):5'- GGCTGGTGCTCATAAAAATCC -3'
(R):5'- AAATGAGCTTCTGTATGGCTGCAG -3'
Posted On2018-11-28