Incidental Mutation 'R6951:Pdzrn3'
ID541261
Institutional Source Beutler Lab
Gene Symbol Pdzrn3
Ensembl Gene ENSMUSG00000035357
Gene NamePDZ domain containing RING finger 3
SynonymsLNX3, semaphorin cytoplasmic domain-associated protein 3A, Semcap3, 1110020C07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.630) question?
Stock #R6951 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location101149609-101377897 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 101154192 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075994]
Predicted Effect probably null
Transcript: ENSMUST00000075994
SMART Domains Protein: ENSMUSP00000075376
Gene: ENSMUSG00000035357

DomainStartEndE-ValueType
RING 18 55 3.93e-3 SMART
low complexity region 198 214 N/A INTRINSIC
PDZ 257 339 3.38e-21 SMART
PDZ 429 504 3.86e-16 SMART
low complexity region 512 526 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 1020 1029 N/A INTRINSIC
Meta Mutation Damage Score 0.9485 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LNX (Ligand of Numb Protein-X) family of RING-type ubiquitin E3 ligases. This protein may function in vascular morphogenesis and the differentiation of adipocytes, osteoblasts and myoblasts. This protein may be targeted for degradation by the human papilloma virus E6 protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A G 4: 58,853,114 probably null Het
Ankrd34a A G 3: 96,598,422 N314S possibly damaging Het
Arhgef3 A T 14: 27,144,018 probably benign Het
Bmp1 T C 14: 70,508,858 R114G probably benign Het
Cenpf A G 1: 189,653,792 L2097P probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnase2a A T 8: 84,909,625 N130I possibly damaging Het
Dpp10 C T 1: 123,341,650 V677M possibly damaging Het
Dsp G A 13: 38,167,646 C147Y possibly damaging Het
Esyt2 A G 12: 116,324,130 T223A probably benign Het
Fndc5 G A 4: 129,138,780 V59I possibly damaging Het
Fsip2 A G 2: 82,981,949 T2871A possibly damaging Het
H2-Eb1 A T 17: 34,309,857 R121* probably null Het
Hydin A G 8: 110,398,125 I589V probably benign Het
Kitl A G 10: 100,051,852 I48V probably damaging Het
Large1 A G 8: 73,116,419 S159P probably damaging Het
Lrba T C 3: 86,745,873 L2570P probably benign Het
Mag G A 7: 30,911,433 T128I possibly damaging Het
Mb21d1 A G 9: 78,442,558 V174A probably damaging Het
Mkrn3 G T 7: 62,419,133 D303E possibly damaging Het
Myo9a A G 9: 59,894,768 D1951G probably damaging Het
Nup85 C T 11: 115,582,955 T565I possibly damaging Het
Olfr1077-ps1 T C 2: 86,525,649 H176R probably damaging Het
Olfr1156 T C 2: 87,949,979 I85V possibly damaging Het
Olfr902 A G 9: 38,448,938 D22G probably benign Het
Olfr915 A G 9: 38,646,874 S217P probably damaging Het
Picalm T A 7: 90,191,375 N434K probably damaging Het
Platr25 A C 13: 62,705,748 D77E probably benign Het
Prr22 A T 17: 56,772,028 R394* probably null Het
Psg23 A T 7: 18,614,711 L57Q probably damaging Het
Rap1gap2 G A 11: 74,484,948 S44L possibly damaging Het
Rffl A G 11: 82,845,750 probably null Het
Stox2 G A 8: 47,203,132 T103I probably damaging Het
Swt1 T C 1: 151,397,268 N543S possibly damaging Het
Tep1 C T 14: 50,833,913 probably null Het
Tln2 A G 9: 67,258,485 Y1023H probably damaging Het
Tssk5 C A 15: 76,372,896 R262L possibly damaging Het
Ttn C T 2: 76,880,642 probably benign Het
Ubtfl1 A T 9: 18,409,577 I134F probably benign Het
Unc80 T C 1: 66,648,511 F2351S possibly damaging Het
Vps13a A T 19: 16,723,740 D688E probably benign Het
Other mutations in Pdzrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Pdzrn3 APN 6 101354486 missense probably benign 0.01
IGL01511:Pdzrn3 APN 6 101153256 missense possibly damaging 0.66
IGL01554:Pdzrn3 APN 6 101150541 missense probably damaging 1.00
IGL02450:Pdzrn3 APN 6 101354500 missense probably damaging 1.00
IGL02505:Pdzrn3 APN 6 101151938 missense possibly damaging 0.94
IGL03061:Pdzrn3 APN 6 101151855 missense probably damaging 1.00
IGL03210:Pdzrn3 APN 6 101156952 missense possibly damaging 0.95
gefilte UTSW 6 101154192 critical splice donor site probably null
implevit_bonis UTSW 6 101151022 missense probably benign 0.15
predisposition UTSW 6 101151053 missense probably damaging 1.00
tendency UTSW 6 101151428 missense probably damaging 1.00
PIT4581001:Pdzrn3 UTSW 6 101151503 missense probably benign 0.00
R0110:Pdzrn3 UTSW 6 101151053 missense probably damaging 1.00
R0469:Pdzrn3 UTSW 6 101151053 missense probably damaging 1.00
R0496:Pdzrn3 UTSW 6 101150570 missense possibly damaging 0.94
R0510:Pdzrn3 UTSW 6 101151053 missense probably damaging 1.00
R0883:Pdzrn3 UTSW 6 101155942 splice site probably null
R1171:Pdzrn3 UTSW 6 101150877 missense probably damaging 1.00
R1471:Pdzrn3 UTSW 6 101151512 missense possibly damaging 0.77
R1496:Pdzrn3 UTSW 6 101150969 missense probably benign 0.00
R1596:Pdzrn3 UTSW 6 101151005 missense probably benign 0.03
R2033:Pdzrn3 UTSW 6 101150954 missense probably damaging 1.00
R2068:Pdzrn3 UTSW 6 101150699 missense probably damaging 1.00
R2084:Pdzrn3 UTSW 6 101154295 missense probably benign 0.35
R2432:Pdzrn3 UTSW 6 101150791 missense probably damaging 1.00
R3727:Pdzrn3 UTSW 6 101156945 missense probably damaging 0.98
R3861:Pdzrn3 UTSW 6 101172371 missense possibly damaging 0.95
R4616:Pdzrn3 UTSW 6 101152009 missense probably damaging 0.99
R4967:Pdzrn3 UTSW 6 101151590 missense probably damaging 1.00
R5224:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5226:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5227:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5230:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5320:Pdzrn3 UTSW 6 101151103 missense probably damaging 1.00
R5414:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5686:Pdzrn3 UTSW 6 101151428 missense probably damaging 1.00
R5772:Pdzrn3 UTSW 6 101172314 missense probably benign 0.00
R6026:Pdzrn3 UTSW 6 101362144 missense probably benign 0.40
R6213:Pdzrn3 UTSW 6 101377844 missense probably damaging 1.00
R6518:Pdzrn3 UTSW 6 101150514 makesense probably null
R6657:Pdzrn3 UTSW 6 101151022 missense probably benign 0.15
R7055:Pdzrn3 UTSW 6 101151774 nonsense probably null
R7290:Pdzrn3 UTSW 6 101151245 missense probably benign
R7608:Pdzrn3 UTSW 6 101151752 missense probably damaging 1.00
R7834:Pdzrn3 UTSW 6 101151195 missense probably damaging 0.97
R7917:Pdzrn3 UTSW 6 101151195 missense probably damaging 0.97
Z1176:Pdzrn3 UTSW 6 101151999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGTCAACCTGCAGTGGGTAG -3'
(R):5'- GCAGTTCAGAAGCACGATG -3'

Sequencing Primer
(F):5'- AGGGCCTGTCAGGTTGGTTAAAC -3'
(R):5'- AGCACGATGGGAGCTTCTG -3'
Posted On2018-11-28