Incidental Mutation 'R7007:Ppp1r26'
ID544753
Institutional Source Beutler Lab
Gene Symbol Ppp1r26
Ensembl Gene ENSMUSG00000035829
Gene Nameprotein phosphatase 1, regulatory subunit 26
SynonymsLOC241289
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7007 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location28446800-28455508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28451159 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 267 (K267I)
Ref Sequence ENSEMBL: ENSMUSP00000139546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040324] [ENSMUST00000189694]
Predicted Effect probably damaging
Transcript: ENSMUST00000040324
AA Change: K267I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042173
Gene: ENSMUSG00000035829
AA Change: K267I

DomainStartEndE-ValueType
Pfam:PPP1R26_N 1 812 N/A PFAM
low complexity region 901 913 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189694
AA Change: K267I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139546
Gene: ENSMUSG00000035829
AA Change: K267I

DomainStartEndE-ValueType
low complexity region 122 132 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 515 536 N/A INTRINSIC
low complexity region 551 559 N/A INTRINSIC
low complexity region 636 654 N/A INTRINSIC
low complexity region 766 780 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (63/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,164 T57I probably benign Het
Adcy8 T C 15: 64,704,716 N999S possibly damaging Het
Adgrv1 T A 13: 81,536,364 I1073F possibly damaging Het
Akap3 A G 6: 126,866,476 D686G probably damaging Het
Alg2 A T 4: 47,471,881 I309N probably benign Het
Ankrd36 A G 11: 5,689,168 E1360G probably benign Het
Aox2 C A 1: 58,330,892 Q788K probably damaging Het
Apoc2 A T 7: 19,673,357 D26E possibly damaging Het
Bbx G A 16: 50,202,488 T703I possibly damaging Het
C2cd4d T C 3: 94,364,071 Y215H probably benign Het
C3 C T 17: 57,218,809 E858K probably benign Het
Ciita T C 16: 10,511,307 L482P probably damaging Het
Cldn9 T C 17: 23,683,078 E191G probably benign Het
Cnst T A 1: 179,610,568 S566T probably damaging Het
Col5a2 A G 1: 45,378,449 I1322T possibly damaging Het
Cp G A 3: 19,969,973 V326M probably damaging Het
Cyp7b1 G A 3: 18,097,618 Q144* probably null Het
Dnah10 T C 5: 124,787,426 S2232P probably damaging Het
Dnah17 T C 11: 118,118,871 E625G possibly damaging Het
Dnah7c T A 1: 46,532,750 D794E probably benign Het
Dusp10 G A 1: 184,037,217 V127M probably benign Het
Dysf G C 6: 84,113,980 W1015C probably damaging Het
Fbxw17 T C 13: 50,423,772 Y104H probably damaging Het
Gm6408 G A 5: 146,483,837 E176K probably damaging Het
Gp1bb T A 16: 18,620,939 D135V possibly damaging Het
Gprin1 C T 13: 54,738,256 C735Y probably damaging Het
Heatr9 T A 11: 83,520,620 M30L possibly damaging Het
Hhat G A 1: 192,693,826 T333I possibly damaging Het
Htr5b A G 1: 121,510,494 F336S probably damaging Het
Ippk T G 13: 49,436,705 probably null Het
Jph1 T A 1: 17,004,186 H11L possibly damaging Het
Kif12 T A 4: 63,166,480 I534L probably benign Het
Lemd3 A T 10: 120,952,232 F523I probably benign Het
Lgsn C A 1: 31,190,427 H76Q probably benign Het
Lipm T A 19: 34,112,097 W152R probably damaging Het
Mei1 A T 15: 82,093,999 R216W probably damaging Het
Mybpc1 C T 10: 88,553,412 G379S probably damaging Het
Myh8 A G 11: 67,288,316 T512A probably benign Het
Nf1 A G 11: 79,447,023 probably null Het
Npc1 T C 18: 12,210,548 T463A probably benign Het
Olfr1145 A G 2: 87,809,886 N22S probably damaging Het
Olfr1383 G A 11: 49,524,184 V154M probably benign Het
Olfr789 A T 10: 129,487,408 I133F probably damaging Het
Osbpl11 T G 16: 33,226,939 I424R possibly damaging Het
Pnmal2 A T 7: 16,946,256 K388N possibly damaging Het
Psmb5 A T 14: 54,616,709 M104K probably damaging Het
Ptges2 T C 2: 32,402,306 V378A probably benign Het
Rcan2 C T 17: 43,836,325 S18F probably benign Het
Sf3b2 C T 19: 5,274,517 R859Q probably benign Het
Slc7a1 G A 5: 148,352,446 Het
Spata31d1a T A 13: 59,703,634 T227S probably benign Het
Sptbn2 T A 19: 4,744,145 V1459E possibly damaging Het
Srgap2 T C 1: 131,319,537 I586V probably benign Het
St6galnac1 G A 11: 116,767,007 R356* probably null Het
Taf5 T A 19: 47,071,211 F265I probably damaging Het
Tex45 A T 8: 3,476,309 D154V probably damaging Het
Tkfc T A 19: 10,596,363 I229L probably benign Het
Tmem132c T A 5: 127,359,615 L56Q probably damaging Het
Togaram2 C T 17: 71,709,643 A665V probably damaging Het
Ttn G A 2: 76,707,046 T34846I probably benign Het
Tyr G A 7: 87,493,340 A4V probably benign Het
Ubap2 A C 4: 41,206,221 F549L probably damaging Het
Usp2 T C 9: 44,090,042 S294P probably damaging Het
Vrk3 A G 7: 44,757,763 N53D probably damaging Het
Zfp324 T C 7: 12,971,215 S444P probably damaging Het
Zfp597 T C 16: 3,865,927 I322V probably benign Het
Other mutations in Ppp1r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Ppp1r26 APN 2 28453718 missense probably damaging 1.00
IGL01092:Ppp1r26 APN 2 28453860 utr 3 prime probably benign
IGL02061:Ppp1r26 APN 2 28450627 missense possibly damaging 0.68
IGL02399:Ppp1r26 APN 2 28453280 missense probably benign
R0518:Ppp1r26 UTSW 2 28452302 missense probably damaging 1.00
R0763:Ppp1r26 UTSW 2 28450367 missense probably damaging 1.00
R1082:Ppp1r26 UTSW 2 28452134 missense probably damaging 1.00
R1477:Ppp1r26 UTSW 2 28452788 missense probably benign 0.00
R1512:Ppp1r26 UTSW 2 28451516 missense probably benign 0.01
R2157:Ppp1r26 UTSW 2 28452358 missense probably benign 0.00
R2228:Ppp1r26 UTSW 2 28453786 missense possibly damaging 0.91
R2275:Ppp1r26 UTSW 2 28452701 missense possibly damaging 0.86
R3015:Ppp1r26 UTSW 2 28452302 missense probably damaging 1.00
R4402:Ppp1r26 UTSW 2 28451606 missense probably benign 0.00
R4614:Ppp1r26 UTSW 2 28450848 missense probably benign 0.04
R5521:Ppp1r26 UTSW 2 28451426 missense probably benign 0.27
R5873:Ppp1r26 UTSW 2 28451605 missense probably benign 0.10
R5988:Ppp1r26 UTSW 2 28452554 missense probably benign 0.01
R6060:Ppp1r26 UTSW 2 28451030 missense probably benign 0.00
R7501:Ppp1r26 UTSW 2 28450737 missense probably damaging 1.00
Z1176:Ppp1r26 UTSW 2 28452847 missense probably damaging 1.00
Z1177:Ppp1r26 UTSW 2 28450892 missense probably benign 0.17
Z1177:Ppp1r26 UTSW 2 28452868 missense probably benign 0.45
Z1177:Ppp1r26 UTSW 2 28453480 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTGAACAGAGCATCCGAGCTG -3'
(R):5'- GTCACTGCTGGAGTCTGATG -3'

Sequencing Primer
(F):5'- CCGAGCTGAAATAGAACAGTTTC -3'
(R):5'- CTGCTGGAGTCTGATGCCTGG -3'
Posted On2019-05-13