Incidental Mutation 'R7007:Tyr'
ID544773
Institutional Source Beutler Lab
Gene Symbol Tyr
Ensembl Gene ENSMUSG00000004651
Gene Nametyrosinase
SynonymsOca1, skc35
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_011661.4; MGI:98880

Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R7007 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location87424771-87493512 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87493340 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 4 (A4V)
Ref Sequence ENSEMBL: ENSMUSP00000146757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004770] [ENSMUST00000207834]
Predicted Effect probably benign
Transcript: ENSMUST00000004770
AA Change: A4V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000004770
Gene: ENSMUSG00000004651
AA Change: A4V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 91 112 N/A INTRINSIC
Pfam:Tyrosinase 170 403 4.8e-45 PFAM
transmembrane domain 474 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207834
AA Change: A4V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene catalyzes the first 2 steps, and at least 1 subsequent step, in the conversion of tyrosine to melanin. The enzyme has both tyrosine hydroxylase and dopa oxidase catalytic activities, and requires copper for function. Mutations in this gene result in oculocutaneous albinism, and nonpathologic polymorphisms result in skin pigmentation variation. The human genome contains a pseudogene similar to the 3' half of this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Numerous mutations at this locus result in albinism or hypopigmentation. Albinism is associated with reduced number of optic nerve fibers and mutants can have impaired vision. Some alleles are lethal. [provided by MGI curators]
Allele List at MGI

All alleles(120) : Targeted(2) Spontaneous(28) Chemically induced(16) Radiation induced(78

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,164 T57I probably benign Het
Adcy8 T C 15: 64,704,716 N999S possibly damaging Het
Adgrv1 T A 13: 81,536,364 I1073F possibly damaging Het
Akap3 A G 6: 126,866,476 D686G probably damaging Het
Alg2 A T 4: 47,471,881 I309N probably benign Het
Ankrd36 A G 11: 5,689,168 E1360G probably benign Het
Aox2 C A 1: 58,330,892 Q788K probably damaging Het
Apoc2 A T 7: 19,673,357 D26E possibly damaging Het
Bbx G A 16: 50,202,488 T703I possibly damaging Het
C2cd4d T C 3: 94,364,071 Y215H probably benign Het
C3 C T 17: 57,218,809 E858K probably benign Het
Ciita T C 16: 10,511,307 L482P probably damaging Het
Cldn9 T C 17: 23,683,078 E191G probably benign Het
Cnst T A 1: 179,610,568 S566T probably damaging Het
Col5a2 A G 1: 45,378,449 I1322T possibly damaging Het
Cp G A 3: 19,969,973 V326M probably damaging Het
Cyp7b1 G A 3: 18,097,618 Q144* probably null Het
Dnah10 T C 5: 124,787,426 S2232P probably damaging Het
Dnah17 T C 11: 118,118,871 E625G possibly damaging Het
Dnah7c T A 1: 46,532,750 D794E probably benign Het
Dusp10 G A 1: 184,037,217 V127M probably benign Het
Dysf G C 6: 84,113,980 W1015C probably damaging Het
Fbxw17 T C 13: 50,423,772 Y104H probably damaging Het
Gm6408 G A 5: 146,483,837 E176K probably damaging Het
Gp1bb T A 16: 18,620,939 D135V possibly damaging Het
Gprin1 C T 13: 54,738,256 C735Y probably damaging Het
Heatr9 T A 11: 83,520,620 M30L possibly damaging Het
Hhat G A 1: 192,693,826 T333I possibly damaging Het
Htr5b A G 1: 121,510,494 F336S probably damaging Het
Ippk T G 13: 49,436,705 probably null Het
Jph1 T A 1: 17,004,186 H11L possibly damaging Het
Kif12 T A 4: 63,166,480 I534L probably benign Het
Lemd3 A T 10: 120,952,232 F523I probably benign Het
Lgsn C A 1: 31,190,427 H76Q probably benign Het
Lipm T A 19: 34,112,097 W152R probably damaging Het
Mei1 A T 15: 82,093,999 R216W probably damaging Het
Mybpc1 C T 10: 88,553,412 G379S probably damaging Het
Myh8 A G 11: 67,288,316 T512A probably benign Het
Nf1 A G 11: 79,447,023 probably null Het
Npc1 T C 18: 12,210,548 T463A probably benign Het
Olfr1145 A G 2: 87,809,886 N22S probably damaging Het
Olfr1383 G A 11: 49,524,184 V154M probably benign Het
Olfr789 A T 10: 129,487,408 I133F probably damaging Het
Osbpl11 T G 16: 33,226,939 I424R possibly damaging Het
Pnmal2 A T 7: 16,946,256 K388N possibly damaging Het
Ppp1r26 A T 2: 28,451,159 K267I probably damaging Het
Psmb5 A T 14: 54,616,709 M104K probably damaging Het
Ptges2 T C 2: 32,402,306 V378A probably benign Het
Rcan2 C T 17: 43,836,325 S18F probably benign Het
Sf3b2 C T 19: 5,274,517 R859Q probably benign Het
Slc7a1 G A 5: 148,352,446 Het
Spata31d1a T A 13: 59,703,634 T227S probably benign Het
Sptbn2 T A 19: 4,744,145 V1459E possibly damaging Het
Srgap2 T C 1: 131,319,537 I586V probably benign Het
St6galnac1 G A 11: 116,767,007 R356* probably null Het
Taf5 T A 19: 47,071,211 F265I probably damaging Het
Tex45 A T 8: 3,476,309 D154V probably damaging Het
Tkfc T A 19: 10,596,363 I229L probably benign Het
Tmem132c T A 5: 127,359,615 L56Q probably damaging Het
Togaram2 C T 17: 71,709,643 A665V probably damaging Het
Ttn G A 2: 76,707,046 T34846I probably benign Het
Ubap2 A C 4: 41,206,221 F549L probably damaging Het
Usp2 T C 9: 44,090,042 S294P probably damaging Het
Vrk3 A G 7: 44,757,763 N53D probably damaging Het
Zfp324 T C 7: 12,971,215 S444P probably damaging Het
Zfp597 T C 16: 3,865,927 I322V probably benign Het
Other mutations in Tyr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Tyr APN 7 87437948 missense probably damaging 1.00
IGL01594:Tyr APN 7 87483814 splice site probably benign
IGL02963:Tyr APN 7 87483997 missense probably benign
IGL03356:Tyr APN 7 87492714 missense possibly damaging 0.71
ghost UTSW 7 87472495 missense probably damaging 1.00
pale_rider UTSW 7 87438023 missense probably damaging 1.00
rufus UTSW 7 87492706 missense probably damaging 1.00
siamese UTSW 7 87438044 missense probably damaging 0.99
Venusaur UTSW 7 87492706 missense probably damaging 1.00
waffle UTSW 7 87493221 missense possibly damaging 0.94
R0322:Tyr UTSW 7 87492917 missense probably benign 0.35
R0479:Tyr UTSW 7 87493221 missense possibly damaging 0.94
R1544:Tyr UTSW 7 87492706 missense probably damaging 1.00
R1546:Tyr UTSW 7 87437992 missense probably benign 0.02
R1606:Tyr UTSW 7 87437971 missense probably benign 0.01
R1666:Tyr UTSW 7 87492941 missense probably damaging 1.00
R2064:Tyr UTSW 7 87492843 missense probably benign 0.13
R2213:Tyr UTSW 7 87492878 missense probably damaging 1.00
R2420:Tyr UTSW 7 87429189 missense probably benign 0.17
R4013:Tyr UTSW 7 87437940 missense probably benign 0.00
R4014:Tyr UTSW 7 87437940 missense probably benign 0.00
R4015:Tyr UTSW 7 87437940 missense probably benign 0.00
R4016:Tyr UTSW 7 87437940 missense probably benign 0.00
R4202:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4205:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4206:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4361:Tyr UTSW 7 87429076 missense probably benign 0.01
R4738:Tyr UTSW 7 87492647 missense probably null 1.00
R5306:Tyr UTSW 7 87438014 missense probably damaging 1.00
R5378:Tyr UTSW 7 87472495 missense probably damaging 1.00
R5395:Tyr UTSW 7 87472490 missense probably damaging 0.98
R5782:Tyr UTSW 7 87493016 missense probably damaging 1.00
R7609:Tyr UTSW 7 87483884 missense probably benign 0.06
R7767:Tyr UTSW 7 87493010 missense probably benign 0.37
R7794:Tyr UTSW 7 87483820 critical splice donor site probably null
R8158:Tyr UTSW 7 87472516 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTTGAAGGGGAACTGAGGTCC -3'
(R):5'- CATGTGCTTTGCAGAAGATAAAAGC -3'

Sequencing Primer
(F):5'- TCCAGATGGTGCACTGGACAG -3'
(R):5'- GCTTTGCAGAAGATAAAAGCTTAGTG -3'
Posted On2019-05-13