Incidental Mutation 'R7007:Psmb5'
ID544790
Institutional Source Beutler Lab
Gene Symbol Psmb5
Ensembl Gene ENSMUSG00000022193
Gene Nameproteasome (prosome, macropain) subunit, beta type 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R7007 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54614119-54618022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54616709 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 104 (M104K)
Ref Sequence ENSEMBL: ENSMUSP00000022803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022803] [ENSMUST00000227257] [ENSMUST00000228446]
PDB Structure
Mouse constitutive 20S proteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse constitutive 20S proteasome [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000022803
AA Change: M104K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022803
Gene: ENSMUSG00000022193
AA Change: M104K

DomainStartEndE-ValueType
low complexity region 17 42 N/A INTRINSIC
Pfam:Proteasome 56 238 8.3e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227257
Predicted Effect probably benign
Transcript: ENSMUST00000228446
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit in the proteasome. This catalytic subunit is not present in the immunoproteasome and is replaced by catalytic subunit 3i (proteasome beta 8 subunit). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,164 T57I probably benign Het
Adcy8 T C 15: 64,704,716 N999S possibly damaging Het
Adgrv1 T A 13: 81,536,364 I1073F possibly damaging Het
Akap3 A G 6: 126,866,476 D686G probably damaging Het
Alg2 A T 4: 47,471,881 I309N probably benign Het
Ankrd36 A G 11: 5,689,168 E1360G probably benign Het
Aox2 C A 1: 58,330,892 Q788K probably damaging Het
Apoc2 A T 7: 19,673,357 D26E possibly damaging Het
Bbx G A 16: 50,202,488 T703I possibly damaging Het
C2cd4d T C 3: 94,364,071 Y215H probably benign Het
C3 C T 17: 57,218,809 E858K probably benign Het
Ciita T C 16: 10,511,307 L482P probably damaging Het
Cldn9 T C 17: 23,683,078 E191G probably benign Het
Cnst T A 1: 179,610,568 S566T probably damaging Het
Col5a2 A G 1: 45,378,449 I1322T possibly damaging Het
Cp G A 3: 19,969,973 V326M probably damaging Het
Cyp7b1 G A 3: 18,097,618 Q144* probably null Het
Dnah10 T C 5: 124,787,426 S2232P probably damaging Het
Dnah17 T C 11: 118,118,871 E625G possibly damaging Het
Dnah7c T A 1: 46,532,750 D794E probably benign Het
Dusp10 G A 1: 184,037,217 V127M probably benign Het
Dysf G C 6: 84,113,980 W1015C probably damaging Het
Fbxw17 T C 13: 50,423,772 Y104H probably damaging Het
Gm6408 G A 5: 146,483,837 E176K probably damaging Het
Gp1bb T A 16: 18,620,939 D135V possibly damaging Het
Gprin1 C T 13: 54,738,256 C735Y probably damaging Het
Heatr9 T A 11: 83,520,620 M30L possibly damaging Het
Hhat G A 1: 192,693,826 T333I possibly damaging Het
Htr5b A G 1: 121,510,494 F336S probably damaging Het
Ippk T G 13: 49,436,705 probably null Het
Jph1 T A 1: 17,004,186 H11L possibly damaging Het
Kif12 T A 4: 63,166,480 I534L probably benign Het
Lemd3 A T 10: 120,952,232 F523I probably benign Het
Lgsn C A 1: 31,190,427 H76Q probably benign Het
Lipm T A 19: 34,112,097 W152R probably damaging Het
Mei1 A T 15: 82,093,999 R216W probably damaging Het
Mybpc1 C T 10: 88,553,412 G379S probably damaging Het
Myh8 A G 11: 67,288,316 T512A probably benign Het
Nf1 A G 11: 79,447,023 probably null Het
Npc1 T C 18: 12,210,548 T463A probably benign Het
Olfr1145 A G 2: 87,809,886 N22S probably damaging Het
Olfr1383 G A 11: 49,524,184 V154M probably benign Het
Olfr789 A T 10: 129,487,408 I133F probably damaging Het
Osbpl11 T G 16: 33,226,939 I424R possibly damaging Het
Pnmal2 A T 7: 16,946,256 K388N possibly damaging Het
Ppp1r26 A T 2: 28,451,159 K267I probably damaging Het
Ptges2 T C 2: 32,402,306 V378A probably benign Het
Rcan2 C T 17: 43,836,325 S18F probably benign Het
Sf3b2 C T 19: 5,274,517 R859Q probably benign Het
Slc7a1 G A 5: 148,352,446 Het
Spata31d1a T A 13: 59,703,634 T227S probably benign Het
Sptbn2 T A 19: 4,744,145 V1459E possibly damaging Het
Srgap2 T C 1: 131,319,537 I586V probably benign Het
St6galnac1 G A 11: 116,767,007 R356* probably null Het
Taf5 T A 19: 47,071,211 F265I probably damaging Het
Tex45 A T 8: 3,476,309 D154V probably damaging Het
Tkfc T A 19: 10,596,363 I229L probably benign Het
Tmem132c T A 5: 127,359,615 L56Q probably damaging Het
Togaram2 C T 17: 71,709,643 A665V probably damaging Het
Ttn G A 2: 76,707,046 T34846I probably benign Het
Tyr G A 7: 87,493,340 A4V probably benign Het
Ubap2 A C 4: 41,206,221 F549L probably damaging Het
Usp2 T C 9: 44,090,042 S294P probably damaging Het
Vrk3 A G 7: 44,757,763 N53D probably damaging Het
Zfp324 T C 7: 12,971,215 S444P probably damaging Het
Zfp597 T C 16: 3,865,927 I322V probably benign Het
Other mutations in Psmb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Psmb5 APN 14 54617807 missense possibly damaging 0.85
IGL02967:Psmb5 APN 14 54616626 missense probably benign 0.11
IGL03095:Psmb5 APN 14 54616557 missense probably damaging 1.00
R2447:Psmb5 UTSW 14 54614470 missense probably damaging 0.97
R5651:Psmb5 UTSW 14 54616764 missense possibly damaging 0.64
R6346:Psmb5 UTSW 14 54616673 missense probably damaging 0.98
R6372:Psmb5 UTSW 14 54616673 missense probably damaging 0.98
R6657:Psmb5 UTSW 14 54614383 missense possibly damaging 0.61
R6687:Psmb5 UTSW 14 54616673 missense probably damaging 0.98
R6688:Psmb5 UTSW 14 54616673 missense probably damaging 0.98
R6752:Psmb5 UTSW 14 54616755 missense probably benign 0.00
R7801:Psmb5 UTSW 14 54616755 missense probably benign 0.00
R8066:Psmb5 UTSW 14 54614241 missense probably benign 0.00
R8278:Psmb5 UTSW 14 54617885 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTATCCCAGCCACAGATCATGG -3'
(R):5'- AGATGCAAAGCCAGGTTATCTTTC -3'

Sequencing Primer
(F):5'- GATCATGGTGCCCATAGACAGC -3'
(R):5'- TGGAGTCATTGTTGCAGC -3'
Posted On2019-05-13