Incidental Mutation 'R4454:Epha5'
ID329081
Institutional Source Beutler Lab
Gene Symbol Epha5
Ensembl Gene ENSMUSG00000029245
Gene NameEph receptor A5
SynonymsRek7, Ehk1, Hek7, Cek7, bsk, Els1
MMRRC Submission 041714-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4454 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location84054761-84417382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84156444 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 501 (I501V)
Ref Sequence ENSEMBL: ENSMUSP00000109033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053733] [ENSMUST00000113398] [ENSMUST00000113399] [ENSMUST00000113401] [ENSMUST00000113403] [ENSMUST00000113406]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053733
AA Change: I337V

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000060646
Gene: ENSMUSG00000029245
AA Change: I337V

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 413 511 2.1e-22 PFAM
TyrKc 514 771 9.33e-138 SMART
SAM 801 868 6.65e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113398
AA Change: I389V

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109025
Gene: ENSMUSG00000029245
AA Change: I389V

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 359 439 1.92e-12 SMART
Pfam:EphA2_TM 465 563 8.4e-23 PFAM
TyrKc 566 823 9.33e-138 SMART
Pfam:SAM_1 854 894 7.2e-11 PFAM
Pfam:SAM_2 856 894 1.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113399
AA Change: I501V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109026
Gene: ENSMUSG00000029245
AA Change: I501V

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 3.4e-22 PFAM
TyrKc 678 935 9.33e-138 SMART
Pfam:SAM_1 966 1006 2.9e-10 PFAM
Pfam:SAM_2 968 1006 5.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113401
AA Change: I337V

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109028
Gene: ENSMUSG00000029245
AA Change: I337V

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 411 488 3.1e-30 PFAM
TyrKc 491 748 9.33e-138 SMART
Pfam:SAM_1 779 819 1.7e-10 PFAM
Pfam:SAM_2 781 819 3.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113403
AA Change: I501V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109030
Gene: ENSMUSG00000029245
AA Change: I501V

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 1.2e-25 PFAM
TyrKc 678 935 9.33e-138 SMART
SAM 965 1032 6.65e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113406
AA Change: I501V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109033
Gene: ENSMUSG00000029245
AA Change: I501V

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 575 652 1.9e-30 PFAM
TyrKc 655 912 9.33e-138 SMART
SAM 942 1009 6.65e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154804
Meta Mutation Damage Score 0.1004 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice are overtly normal but show abnormal retinal axon mapping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,753 E163G probably damaging Het
AI481877 T C 4: 59,092,383 D266G possibly damaging Het
Ap4e1 T A 2: 127,047,141 F509I probably damaging Het
Asmt A T X: 170,672,721 M19L probably benign Het
Atf6 C T 1: 170,794,039 R471Q probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Baiap3 T A 17: 25,249,536 D250V probably damaging Het
C2cd4d T A 3: 94,363,747 F107I probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Cldn6 T C 17: 23,681,086 probably null Het
Cpa5 A G 6: 30,626,324 N228S possibly damaging Het
Crocc T C 4: 141,020,405 S1478G possibly damaging Het
Csmd1 A T 8: 15,945,011 C2675S probably damaging Het
Cthrc1 C A 15: 39,077,013 Q4K probably benign Het
Ddo A T 10: 40,647,547 I178F probably damaging Het
Dmxl1 A G 18: 49,893,332 T1836A probably benign Het
Dnah9 T G 11: 66,147,389 Q107P probably damaging Het
Dusp26 A G 8: 31,094,144 N93S probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Fgd5 C T 6: 91,989,186 S642F probably damaging Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gm12034 T A 11: 20,446,476 noncoding transcript Het
Gm13023 A G 4: 143,792,824 S52G probably benign Het
Liph T C 16: 21,984,268 D17G probably benign Het
Mbd3 A T 10: 80,393,983 L164H probably damaging Het
Med4 A G 14: 73,518,062 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nav2 A T 7: 49,548,544 probably null Het
Olfr728 T C 14: 50,140,496 I48V probably benign Het
Olfr904 C A 9: 38,464,642 F200L probably benign Het
Pcdha11 G A 18: 37,007,373 G685D probably benign Het
Pgc A G 17: 47,732,410 I228V probably benign Het
Rad51 C T 2: 119,131,568 H199Y probably damaging Het
Robo2 A T 16: 74,352,519 probably benign Het
Sap130 C T 18: 31,711,360 T861I probably damaging Het
Sh3tc2 A T 18: 62,007,773 D1061V probably damaging Het
Snapc3 A G 4: 83,418,759 E119G probably damaging Het
Sspo G A 6: 48,487,225 G3862D probably benign Het
Tbc1d16 G A 11: 119,157,873 T318M possibly damaging Het
Thrb T A 14: 18,011,187 W188R probably damaging Het
Thsd1 T C 8: 22,243,578 Y214H probably damaging Het
Tnfrsf13b T C 11: 61,141,438 V98A probably benign Het
Topbp1 T C 9: 103,344,871 Y1314H probably damaging Het
Ttn C A 2: 76,785,806 V8271L possibly damaging Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Utrn G T 10: 12,727,840 Q599K possibly damaging Het
Zfp995 G A 17: 21,879,951 T434I probably benign Het
Zfy1 G T Y: 725,518 T749K possibly damaging Het
Other mutations in Epha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Epha5 APN 5 84106700 missense probably damaging 1.00
IGL01084:Epha5 APN 5 84071087 nonsense probably null
IGL01462:Epha5 APN 5 84071233 missense probably damaging 1.00
IGL01516:Epha5 APN 5 84386276 missense probably damaging 1.00
IGL01998:Epha5 APN 5 84084734 missense probably damaging 1.00
IGL02744:Epha5 APN 5 84107989 missense probably benign 0.22
IGL03076:Epha5 APN 5 84331690 missense probably damaging 1.00
IGL03123:Epha5 APN 5 84331226 critical splice donor site probably null
IGL03381:Epha5 APN 5 84331332 missense probably damaging 0.98
BB001:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
BB011:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
PIT4544001:Epha5 UTSW 5 84331612 missense possibly damaging 0.71
R0004:Epha5 UTSW 5 84331842 missense probably damaging 1.00
R0490:Epha5 UTSW 5 84107974 splice site probably benign
R0545:Epha5 UTSW 5 84067358 critical splice donor site probably null
R0835:Epha5 UTSW 5 84386242 missense probably damaging 1.00
R1074:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1074:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1102:Epha5 UTSW 5 84233575 splice site probably benign
R1184:Epha5 UTSW 5 84071275 splice site probably null
R1255:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1255:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1327:Epha5 UTSW 5 84106785 missense probably damaging 1.00
R1437:Epha5 UTSW 5 84233696 missense probably damaging 1.00
R1804:Epha5 UTSW 5 84331815 missense probably benign 0.21
R1967:Epha5 UTSW 5 84416429 missense probably benign 0.23
R2187:Epha5 UTSW 5 84086364 missense probably damaging 1.00
R2282:Epha5 UTSW 5 84150410 missense probably damaging 1.00
R2899:Epha5 UTSW 5 84233808 missense probably damaging 0.99
R3746:Epha5 UTSW 5 84059104 missense probably damaging 1.00
R4771:Epha5 UTSW 5 84150419 missense probably damaging 0.99
R4809:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4810:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4825:Epha5 UTSW 5 84233840 missense probably damaging 0.97
R4833:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4961:Epha5 UTSW 5 84233643 missense probably damaging 1.00
R4976:Epha5 UTSW 5 84084824 missense probably damaging 1.00
R4981:Epha5 UTSW 5 84150483 missense probably damaging 1.00
R5149:Epha5 UTSW 5 84150358 missense probably damaging 1.00
R5422:Epha5 UTSW 5 84331490 missense probably damaging 1.00
R5575:Epha5 UTSW 5 84416502 missense probably damaging 0.97
R5664:Epha5 UTSW 5 84331866 missense probably damaging 1.00
R5801:Epha5 UTSW 5 84331226 critical splice donor site probably null
R5821:Epha5 UTSW 5 84084728 missense probably damaging 1.00
R5924:Epha5 UTSW 5 84233674 nonsense probably null
R5951:Epha5 UTSW 5 84331192 intron probably benign
R5956:Epha5 UTSW 5 84150369 missense probably damaging 0.99
R6127:Epha5 UTSW 5 84071094 missense probably damaging 1.00
R6189:Epha5 UTSW 5 84237540 missense probably damaging 1.00
R6240:Epha5 UTSW 5 84117579 missense probably benign 0.27
R6343:Epha5 UTSW 5 84106747 missense probably damaging 1.00
R6463:Epha5 UTSW 5 84106710 missense probably damaging 1.00
R6517:Epha5 UTSW 5 84156501 missense possibly damaging 0.63
R6622:Epha5 UTSW 5 84237528 missense possibly damaging 0.79
R6667:Epha5 UTSW 5 84071191 missense probably damaging 1.00
R6741:Epha5 UTSW 5 84106698 missense possibly damaging 0.69
R6757:Epha5 UTSW 5 84105878 missense probably damaging 1.00
R6762:Epha5 UTSW 5 84331726 missense probably damaging 1.00
R6819:Epha5 UTSW 5 84106790 missense probably damaging 1.00
R7019:Epha5 UTSW 5 84416462 missense possibly damaging 0.68
R7031:Epha5 UTSW 5 84142300 missense probably benign 0.12
R7213:Epha5 UTSW 5 84233923 splice site probably null
R7728:Epha5 UTSW 5 84067408 missense possibly damaging 0.95
R7924:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
R7953:Epha5 UTSW 5 84233654 missense probably benign 0.19
R8043:Epha5 UTSW 5 84233654 missense probably benign 0.19
Z1088:Epha5 UTSW 5 84237522 missense probably benign 0.01
Z1176:Epha5 UTSW 5 84071120 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GACTATAAGGCCTTATCCTTGAGCAG -3'
(R):5'- ACCAATTGTGACACAGAGTAAGC -3'

Sequencing Primer
(F):5'- CTCACTGGCAGCATCTGAAGTAG -3'
(R):5'- CAGAGTAAGCAGTAATTTCGGGTCTC -3'
Posted On2015-07-21