Mutagenetix > Incidental Mutation

Incidental Mutation 'R0545:Epha5'

44750

Institutional Source

Beutler Lab

Gene Symbol

Epha5

Ensembl Gene

ENSMUSG00000029245

Gene Name

Eph receptor A5

Synonyms

Rek7, Ehk1, Hek7, Cek7, bsk, Els1

MMRRC Submission

038737-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0545 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84054761-84417382 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 84067358 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000109033 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053733] [ENSMUST00000113398] [ENSMUST00000113399] [ENSMUST00000113401] [ENSMUST00000113403] [ENSMUST00000113406]

AlphaFold

Q60629

Predicted Effect

probably null
Transcript: ENSMUST00000053733

SMART Domains

Protein: ENSMUSP00000060646
Gene: ENSMUSG00000029245

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	307	387	1.92e-12	SMART
Pfam:EphA2_TM	413	511	2.1e-22	PFAM
TyrKc	514	771	9.33e-138	SMART
SAM	801	868	6.65e-23	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113398
AA Change: *895R

SMART Domains

Protein: ENSMUSP00000109025
Gene: ENSMUSG00000029245
AA Change: *895R

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	359	439	1.92e-12	SMART
Pfam:EphA2_TM	465	563	8.4e-23	PFAM
TyrKc	566	823	9.33e-138	SMART
Pfam:SAM_1	854	894	7.2e-11	PFAM
Pfam:SAM_2	856	894	1.6e-9	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000113399
AA Change: *1007R

SMART Domains

Protein: ENSMUSP00000109026
Gene: ENSMUSG00000029245
AA Change: *1007R

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	360	450	1.53e-6	SMART
FN3	471	551	1.92e-12	SMART
Pfam:EphA2_TM	577	675	3.4e-22	PFAM
TyrKc	678	935	9.33e-138	SMART
Pfam:SAM_1	966	1006	2.9e-10	PFAM
Pfam:SAM_2	968	1006	5.9e-9	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000113401
AA Change: *820R

SMART Domains

Protein: ENSMUSP00000109028
Gene: ENSMUSG00000029245
AA Change: *820R

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	307	387	1.92e-12	SMART
Pfam:EphA2_TM	411	488	3.1e-30	PFAM
TyrKc	491	748	9.33e-138	SMART
Pfam:SAM_1	779	819	1.7e-10	PFAM
Pfam:SAM_2	781	819	3.5e-9	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000113403

SMART Domains

Protein: ENSMUSP00000109030
Gene: ENSMUSG00000029245

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	360	450	1.53e-6	SMART
FN3	471	551	1.92e-12	SMART
Pfam:EphA2_TM	577	675	1.2e-25	PFAM
TyrKc	678	935	9.33e-138	SMART
SAM	965	1032	6.65e-23	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113406

SMART Domains

Protein: ENSMUSP00000109033
Gene: ENSMUSG00000029245

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	360	450	1.53e-6	SMART
FN3	471	551	1.92e-12	SMART
Pfam:EphA2_TM	575	652	1.9e-30	PFAM
TyrKc	655	912	9.33e-138	SMART
SAM	942	1009	6.65e-23	SMART

Meta Mutation Damage Score

0.9488

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.9%
20x: 94.0%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice are overtly normal but show abnormal retinal axon mapping. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	C	T	2: 19,542,376	R76H	probably damaging	Het
4932438A13Rik	G	A	3: 36,987,690		probably benign	Het
Adnp2	T	C	18: 80,129,401	I598V	probably benign	Het
Ago3	T	C	4: 126,417,232	N63D	probably damaging	Het
Alkbh7	C	T	17: 56,999,012	R138*	probably null	Het
Atp6ap1l	T	C	13: 90,883,663	H300R	probably benign	Het
BC051076	C	T	5: 87,963,490		noncoding transcript	Het
Bpifb9a	T	A	2: 154,261,950	C104*	probably null	Het
Cacna2d2	T	C	9: 107,525,223	L826P	probably damaging	Het
Car5b	G	A	X: 163,979,301	R282C	probably damaging	Het
Ccdc88c	T	C	12: 100,947,188	D526G	probably damaging	Het
Cdh23	T	A	10: 60,331,291	T1861S	probably benign	Het
Ces2f	A	C	8: 104,950,036	M121L	possibly damaging	Het
Cfap58	G	A	19: 47,941,097		probably benign	Het
Chpf2	T	C	5: 24,590,324	S282P	possibly damaging	Het
Cluap1	C	T	16: 3,933,772	R332W	probably damaging	Het
Cma2	A	T	14: 55,973,113	M86L	probably benign	Het
Cog6	A	T	3: 52,996,075	M134K	probably damaging	Het
Col1a1	A	G	11: 94,951,594	D1446G	unknown	Het
Cpne8	T	A	15: 90,497,075	D512V	probably damaging	Het
Ctnna2	T	A	6: 77,605,182	N352I	probably damaging	Het
Cyp2c69	A	C	19: 39,886,661	L16R	probably damaging	Het
Dysf	T	C	6: 84,099,461	S603P	probably damaging	Het
Ercc3	T	C	18: 32,245,902	S270P	probably damaging	Het
F10	T	A	8: 13,048,249	C151S	probably damaging	Het
Gpr180	T	G	14: 118,160,046	H317Q	possibly damaging	Het
Gstp2	T	C	19: 4,041,633	E32G	possibly damaging	Het
Ikzf5	T	C	7: 131,392,500	T133A	possibly damaging	Het
Itch	G	T	2: 155,182,298	G274*	probably null	Het
Jarid2	T	A	13: 44,902,831	N365K	probably benign	Het
Lama3	T	A	18: 12,561,701	S1295T	possibly damaging	Het
Lipc	A	G	9: 70,812,705	L255P	probably damaging	Het
Lrrc38	A	G	4: 143,350,758	D197G	probably benign	Het
Mfap2	A	G	4: 141,014,185		probably benign	Het
Mfhas1	A	G	8: 35,589,048	K226E	probably damaging	Het
Morc1	A	G	16: 48,565,657	R548G	probably benign	Het
Mrgprb5	T	C	7: 48,168,885	N34S	probably benign	Het
Mroh4	T	C	15: 74,625,427	T182A	probably benign	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Myo5a	T	C	9: 75,167,037	F743L	possibly damaging	Het
Notch4	A	C	17: 34,583,433	D1276A	probably damaging	Het
Olfr139	A	G	11: 74,045,047	C76R	possibly damaging	Het
Olfr215	T	A	6: 116,582,656	I97L	probably benign	Het
Olfr394	A	T	11: 73,888,017	Y118*	probably null	Het
Olfr799	T	A	10: 129,647,349	C74S	probably damaging	Het
Plin4	T	A	17: 56,106,567	T353S	probably damaging	Het
Ppp1r9a	A	G	6: 5,115,357	T827A	probably benign	Het
Prlr	C	T	15: 10,317,566	T40I	probably damaging	Het
Psme3	T	C	11: 101,319,904		probably benign	Het
Pygb	A	T	2: 150,815,706	D363V	probably benign	Het
Rsph6a	C	T	7: 19,054,946	Q68*	probably null	Het
Serpini2	A	G	3: 75,258,138	V178A	probably benign	Het
Sh2d2a	T	C	3: 87,851,888		probably benign	Het
Skint7	A	C	4: 111,980,198	M58L	probably benign	Het
Slco3a1	G	T	7: 74,320,553	Y435*	probably null	Het
Stk17b	T	C	1: 53,762,583		probably benign	Het
Tinag	T	A	9: 77,031,710	H162L	possibly damaging	Het
Ttc21a	T	A	9: 119,958,799	L811Q	probably damaging	Het
Ttc41	A	T	10: 86,759,097	M912L	probably benign	Het
Vmn2r98	G	T	17: 19,053,613	V41F	probably benign	Het
Washc5	C	T	15: 59,342,093	C838Y	possibly damaging	Het
Wrnip1	A	G	13: 32,806,813	T352A	probably damaging	Het
Zan	A	C	5: 137,396,177	C4467G	unknown	Het
Zc3h7a	T	C	16: 11,152,333		probably benign	Het
Zfp729a	C	A	13: 67,620,226	C628F	probably benign	Het

Other mutations in Epha5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00808:Epha5	APN	5	84106700	missense	probably damaging	1.00
IGL01084:Epha5	APN	5	84071087	nonsense	probably null
IGL01462:Epha5	APN	5	84071233	missense	probably damaging	1.00
IGL01516:Epha5	APN	5	84386276	missense	probably damaging	1.00
IGL01998:Epha5	APN	5	84084734	missense	probably damaging	1.00
IGL02744:Epha5	APN	5	84107989	missense	probably benign	0.22
IGL03076:Epha5	APN	5	84331690	missense	probably damaging	1.00
IGL03123:Epha5	APN	5	84331226	critical splice donor site	probably null
IGL03381:Epha5	APN	5	84331332	missense	probably damaging	0.98
BB001:Epha5	UTSW	5	84084846	missense	possibly damaging	0.71
BB011:Epha5	UTSW	5	84084846	missense	possibly damaging	0.71
PIT4544001:Epha5	UTSW	5	84331612	missense	possibly damaging	0.71
R0004:Epha5	UTSW	5	84331842	missense	probably damaging	1.00
R0490:Epha5	UTSW	5	84107974	splice site	probably benign
R0835:Epha5	UTSW	5	84386242	missense	probably damaging	1.00
R1074:Epha5	UTSW	5	84150395	missense	probably damaging	0.99
R1074:Epha5	UTSW	5	84150396	missense	probably damaging	0.99
R1075:Epha5	UTSW	5	84150395	missense	probably damaging	0.99
R1075:Epha5	UTSW	5	84150396	missense	probably damaging	0.99
R1102:Epha5	UTSW	5	84233575	splice site	probably benign
R1184:Epha5	UTSW	5	84071275	splice site	probably null
R1255:Epha5	UTSW	5	84150395	missense	probably damaging	0.99
R1255:Epha5	UTSW	5	84150396	missense	probably damaging	0.99
R1327:Epha5	UTSW	5	84106785	missense	probably damaging	1.00
R1437:Epha5	UTSW	5	84233696	missense	probably damaging	1.00
R1804:Epha5	UTSW	5	84331815	missense	probably benign	0.21
R1967:Epha5	UTSW	5	84416429	missense	probably benign	0.23
R2187:Epha5	UTSW	5	84086364	missense	probably damaging	1.00
R2282:Epha5	UTSW	5	84150410	missense	probably damaging	1.00
R2899:Epha5	UTSW	5	84233808	missense	probably damaging	0.99
R3746:Epha5	UTSW	5	84059104	missense	probably damaging	1.00
R4454:Epha5	UTSW	5	84156444	missense	probably damaging	1.00
R4771:Epha5	UTSW	5	84150419	missense	probably damaging	0.99
R4809:Epha5	UTSW	5	84105891	missense	possibly damaging	0.88
R4810:Epha5	UTSW	5	84105891	missense	possibly damaging	0.88
R4825:Epha5	UTSW	5	84233840	missense	probably damaging	0.97
R4833:Epha5	UTSW	5	84105891	missense	possibly damaging	0.88
R4961:Epha5	UTSW	5	84233643	missense	probably damaging	1.00
R4976:Epha5	UTSW	5	84084824	missense	probably damaging	1.00
R4981:Epha5	UTSW	5	84150483	missense	probably damaging	1.00
R5149:Epha5	UTSW	5	84150358	missense	probably damaging	1.00
R5422:Epha5	UTSW	5	84331490	missense	probably damaging	1.00
R5575:Epha5	UTSW	5	84416502	missense	probably damaging	0.97
R5664:Epha5	UTSW	5	84331866	missense	probably damaging	1.00
R5801:Epha5	UTSW	5	84331226	critical splice donor site	probably null
R5821:Epha5	UTSW	5	84084728	missense	probably damaging	1.00
R5924:Epha5	UTSW	5	84233674	nonsense	probably null
R5951:Epha5	UTSW	5	84331192	intron	probably benign
R5956:Epha5	UTSW	5	84150369	missense	probably damaging	0.99
R6127:Epha5	UTSW	5	84071094	missense	probably damaging	1.00
R6189:Epha5	UTSW	5	84237540	missense	probably damaging	1.00
R6240:Epha5	UTSW	5	84117579	missense	probably benign	0.27
R6343:Epha5	UTSW	5	84106747	missense	probably damaging	1.00
R6463:Epha5	UTSW	5	84106710	missense	probably damaging	1.00
R6517:Epha5	UTSW	5	84156501	missense	possibly damaging	0.63
R6622:Epha5	UTSW	5	84237528	missense	possibly damaging	0.79
R6667:Epha5	UTSW	5	84071191	missense	probably damaging	1.00
R6741:Epha5	UTSW	5	84106698	missense	possibly damaging	0.69
R6757:Epha5	UTSW	5	84105878	missense	probably damaging	1.00
R6762:Epha5	UTSW	5	84331726	missense	probably damaging	1.00
R6819:Epha5	UTSW	5	84106790	missense	probably damaging	1.00
R7019:Epha5	UTSW	5	84416462	missense	possibly damaging	0.68
R7031:Epha5	UTSW	5	84142300	missense	probably benign	0.12
R7213:Epha5	UTSW	5	84233923	splice site	probably null
R7728:Epha5	UTSW	5	84067408	missense	possibly damaging	0.95
R7924:Epha5	UTSW	5	84084846	missense	possibly damaging	0.71
R7953:Epha5	UTSW	5	84233654	missense	probably benign	0.19
R8043:Epha5	UTSW	5	84233654	missense	probably benign	0.19
R8468:Epha5	UTSW	5	84142416	splice site	probably null
R8558:Epha5	UTSW	5	84059116	missense	probably damaging	1.00
R8796:Epha5	UTSW	5	84107991	missense	probably damaging	0.97
R9035:Epha5	UTSW	5	84108027	missense	probably damaging	1.00
R9060:Epha5	UTSW	5	84071118	missense	probably benign	0.01
R9244:Epha5	UTSW	5	84117582	missense	probably benign	0.28
R9347:Epha5	UTSW	5	84331872	missense	possibly damaging	0.51
R9355:Epha5	UTSW	5	84106031	missense	probably damaging	1.00
R9434:Epha5	UTSW	5	84331368	missense	possibly damaging	0.72
Z1088:Epha5	UTSW	5	84237522	missense	probably benign	0.01
Z1176:Epha5	UTSW	5	84071120	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TCCCAATTATCCAAACACTCAAGTGAGG -3'
(R):5'- GCCCACATTCATAGACTACAATAAACGTCTAA -3'

Sequencing Primer
(F):5'- CACTCAAGTGAGGTTGGATGAAC -3'
(R):5'- GATGATTGCATATCTTCCCTATGAC -3'

Posted On

2013-06-11