Incidental Mutation 'R7044:Vmn1r77'
ID547206
Institutional Source Beutler Lab
Gene Symbol Vmn1r77
Ensembl Gene ENSMUSG00000095864
Gene Namevomeronasal 1 receptor 77
SynonymsGm6935
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R7044 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location12036752-12049295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12041834 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 179 (R179Q)
Ref Sequence ENSEMBL: ENSMUSP00000153872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164446] [ENSMUST00000226525] [ENSMUST00000227320] [ENSMUST00000228213]
Predicted Effect probably benign
Transcript: ENSMUST00000164446
AA Change: R179Q

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000130869
Gene: ENSMUSG00000095864
AA Change: R179Q

DomainStartEndE-ValueType
Pfam:TAS2R 1 300 1.9e-12 PFAM
Pfam:V1R 35 299 5.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226525
AA Change: R111Q

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000227320
AA Change: R179Q

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000228213
AA Change: R111Q

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Eya1 T A 1: 14,231,410 probably null Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Trmt11 A G 10: 30,590,934 F72L probably benign Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Zfp600 C T 4: 146,195,322 Q187* probably null Het
Other mutations in Vmn1r77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Vmn1r77 APN 7 12041296 critical splice acceptor site probably null
IGL00990:Vmn1r77 APN 7 12041476 missense probably benign 0.05
IGL00990:Vmn1r77 APN 7 12041768 missense probably benign 0.00
IGL01304:Vmn1r77 APN 7 12042035 missense probably damaging 1.00
IGL01360:Vmn1r77 APN 7 12041388 missense probably benign 0.06
IGL01714:Vmn1r77 APN 7 12041350 missense probably benign 0.03
IGL01829:Vmn1r77 APN 7 12041431 missense probably damaging 1.00
IGL02336:Vmn1r77 APN 7 12041296 critical splice acceptor site probably null
R0456:Vmn1r77 UTSW 7 12041738 nonsense probably null
R0622:Vmn1r77 UTSW 7 12041388 missense probably benign 0.06
R1244:Vmn1r77 UTSW 7 12041920 missense possibly damaging 0.59
R1696:Vmn1r77 UTSW 7 12041620 nonsense probably null
R1836:Vmn1r77 UTSW 7 12041411 missense probably benign 0.00
R1898:Vmn1r77 UTSW 7 12041623 missense probably damaging 1.00
R4533:Vmn1r77 UTSW 7 12041829 missense probably benign 0.02
R4668:Vmn1r77 UTSW 7 12041431 missense probably damaging 1.00
R5381:Vmn1r77 UTSW 7 12042025 missense probably damaging 1.00
R6290:Vmn1r77 UTSW 7 12041809 missense probably damaging 1.00
R6675:Vmn1r77 UTSW 7 12041455 missense probably damaging 1.00
R7032:Vmn1r77 UTSW 7 12042090 nonsense probably null
R7302:Vmn1r77 UTSW 7 12042056 missense possibly damaging 0.94
R7417:Vmn1r77 UTSW 7 12041684 missense probably damaging 1.00
R7436:Vmn1r77 UTSW 7 12041767 missense probably benign 0.01
Z1176:Vmn1r77 UTSW 7 12041581 missense
Z1176:Vmn1r77 UTSW 7 12041597 missense probably benign 0.36
Z1176:Vmn1r77 UTSW 7 12041747 missense
Z1176:Vmn1r77 UTSW 7 12041768 missense probably benign 0.00
Z1177:Vmn1r77 UTSW 7 12041597 missense probably benign 0.36
Z1177:Vmn1r77 UTSW 7 12041747 missense
Z1177:Vmn1r77 UTSW 7 12041768 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGATGAAGCTTAAATACAGAGCC -3'
(R):5'- GTCCTAATGACAGCAACAAGGG -3'

Sequencing Primer
(F):5'- TACAGAGCCACCAAGTACATTG -3'
(R):5'- ATGAGGATAATTTTTGATGCTCTGTC -3'
Posted On2019-05-13