Incidental Mutation 'R7063:Casr'
ID548415
Institutional Source Beutler Lab
Gene Symbol Casr
Ensembl Gene ENSMUSG00000051980
Gene Namecalcium-sensing receptor
SynonymsCaR, cation sensing receptor, Gprc2a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7063 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location36493696-36562141 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36494574 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 968 (I968V)
Ref Sequence ENSEMBL: ENSMUSP00000110496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063597] [ENSMUST00000114847] [ENSMUST00000172826]
Predicted Effect probably benign
Transcript: ENSMUST00000063597
AA Change: I1045V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069080
Gene: ENSMUSG00000051980
AA Change: I1045V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Peripla_BP_6 63 321 1e-13 PFAM
Pfam:ANF_receptor 69 495 1.1e-114 PFAM
Pfam:NCD3G 538 591 1.4e-20 PFAM
Pfam:7tm_3 624 859 7.4e-61 PFAM
low complexity region 894 920 N/A INTRINSIC
low complexity region 930 961 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114847
AA Change: I968V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000110496
Gene: ENSMUSG00000051980
AA Change: I968V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Peripla_BP_6 63 321 2.1e-14 PFAM
Pfam:ANF_receptor 69 461 2.8e-99 PFAM
Pfam:NCD3G 461 514 1.2e-20 PFAM
Pfam:7tm_3 545 783 9.9e-87 PFAM
low complexity region 817 843 N/A INTRINSIC
low complexity region 853 884 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172826
AA Change: I1045V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133500
Gene: ENSMUSG00000051980
AA Change: I1045V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Peripla_BP_6 63 321 2.4e-14 PFAM
Pfam:ANF_receptor 69 495 3.9e-111 PFAM
Pfam:NCD3G 538 591 1.4e-20 PFAM
Pfam:7tm_3 622 860 1.1e-86 PFAM
low complexity region 894 920 N/A INTRINSIC
low complexity region 930 961 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor that is expressed in the parathyroid hormone (PTH)-producing chief cells of the parathyroid gland, and the cells lining the kidney tubule. It senses small changes in circulating calcium concentration and couples this information to intracellular signaling pathways that modify PTH secretion or renal cation handling, thus this protein plays an essential role in maintaining mineral ion homeostasis. Mutations in this gene cause familial hypocalciuric hypercalcemia, familial, isolated hypoparathyroidism, and neonatal severe primary hyperparathyroidism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high levels of serum calcium and parathyroid hormone, parathyroid hyperplasia, bone defects, reduced growth, and early death. Carriers have elevated serum calcium, magnesium, and parathyroid hormone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A G 7: 16,565,113 V9A probably benign Het
Btbd6 A G 12: 112,977,512 Y148C probably damaging Het
C130060K24Rik A G 6: 65,441,403 probably benign Het
Celf1 T C 2: 91,012,844 probably null Het
Chst2 G T 9: 95,405,568 R242S probably benign Het
Clca3a1 T A 3: 144,755,206 D228V probably damaging Het
Cwf19l2 A G 9: 3,430,532 Y288C probably benign Het
Cyp2r1 A G 7: 114,552,949 S49P probably damaging Het
Dnah5 A G 15: 28,233,248 E251G probably benign Het
Eepd1 A G 9: 25,483,036 R199G possibly damaging Het
Fat1 C T 8: 45,040,775 T3986I probably benign Het
Gbp4 G A 5: 105,118,448 R576C probably damaging Het
Glp1r A G 17: 30,925,558 Y235C probably damaging Het
Gm31371 G A 8: 19,903,412 C7Y Het
Gm6408 T C 5: 146,483,784 I158T probably benign Het
Gpr89 C G 3: 96,875,698 R312P probably damaging Het
Idh2 A G 7: 80,095,684 V403A probably damaging Het
Lclat1 A G 17: 73,239,991 E301G possibly damaging Het
Lgmn A G 12: 102,402,678 Y181H probably damaging Het
Lgr5 T C 10: 115,456,734 Y417C probably damaging Het
Man1a G T 10: 54,030,744 N311K probably damaging Het
Nat10 G A 2: 103,748,077 L228F probably benign Het
Olfr1417 A G 19: 11,828,184 F281L probably damaging Het
Olfr1445 A G 19: 12,884,085 D68G probably damaging Het
Olfr476 C A 7: 107,968,204 A269E probably benign Het
Olfr958 T G 9: 39,550,115 Y252S possibly damaging Het
Pcmtd2 T A 2: 181,854,983 Y130* probably null Het
Rapgef5 A G 12: 117,689,129 D62G possibly damaging Het
Serpina3m A T 12: 104,391,467 I217L probably benign Het
Supt16 T C 14: 52,172,048 R802G possibly damaging Het
Sypl2 A T 3: 108,217,655 M130K probably benign Het
Tmtc2 A T 10: 105,348,525 L503Q probably damaging Het
Ubald2 A G 11: 116,434,617 Q60R probably benign Het
Vav1 C T 17: 57,311,860 Q673* probably null Het
Vgll2 T C 10: 52,027,976 S312P probably benign Het
Vmn1r191 C T 13: 22,178,694 A297T probably benign Het
Vmn1r7 T A 6: 57,024,433 I281F possibly damaging Het
Vmn2r108 T C 17: 20,481,148 Y30C probably damaging Het
Vmn2r16 A G 5: 109,363,784 N619S probably damaging Het
Vstm5 A G 9: 15,239,253 probably benign Het
Zfp7 A G 15: 76,891,719 I654V possibly damaging Het
Zmat2 A G 18: 36,796,574 N129S probably null Het
Other mutations in Casr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Casr APN 16 36495810 missense probably damaging 1.00
IGL01587:Casr APN 16 36509765 missense probably benign
IGL02323:Casr APN 16 36509710 missense probably damaging 1.00
IGL02369:Casr APN 16 36494689 missense probably benign 0.03
IGL02514:Casr APN 16 36500325 missense probably damaging 1.00
IGL02547:Casr APN 16 36515674 missense probably benign 0.06
IGL02633:Casr APN 16 36515655 missense probably damaging 1.00
IGL03061:Casr APN 16 36495888 missense probably benign 0.07
R1163:Casr UTSW 16 36494807 missense probably damaging 1.00
R1539:Casr UTSW 16 36495137 missense probably benign 0.10
R1643:Casr UTSW 16 36500205 missense probably damaging 1.00
R1664:Casr UTSW 16 36509965 nonsense probably null
R1694:Casr UTSW 16 36495591 missense probably damaging 1.00
R2040:Casr UTSW 16 36510366 missense possibly damaging 0.79
R2092:Casr UTSW 16 36510043 missense possibly damaging 0.96
R2125:Casr UTSW 16 36495252 missense possibly damaging 0.90
R2190:Casr UTSW 16 36495416 missense probably damaging 1.00
R2214:Casr UTSW 16 36515758 missense probably damaging 1.00
R4409:Casr UTSW 16 36500341 missense probably benign 0.01
R4410:Casr UTSW 16 36500341 missense probably benign 0.01
R4591:Casr UTSW 16 36500370 missense probably benign 0.05
R5451:Casr UTSW 16 36509908 missense probably damaging 0.99
R5469:Casr UTSW 16 36510030 missense probably benign 0.29
R5581:Casr UTSW 16 36494744 missense probably benign 0.01
R5700:Casr UTSW 16 36509617 missense probably damaging 0.99
R6258:Casr UTSW 16 36517609 missense probably damaging 1.00
R6447:Casr UTSW 16 36495545 missense probably damaging 1.00
R6751:Casr UTSW 16 36515588 missense probably benign 0.00
R6938:Casr UTSW 16 36495921 missense probably damaging 1.00
R7313:Casr UTSW 16 36509671 missense probably damaging 1.00
R7789:Casr UTSW 16 36495291 missense probably damaging 1.00
R8013:Casr UTSW 16 36509644 missense probably benign 0.22
R8026:Casr UTSW 16 36495617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGAGTACAGGCTTTGATG -3'
(R):5'- GCCTCAGAAGAATGCTATGGC -3'

Sequencing Primer
(F):5'- AGTACAGGCTTTGATGCACCC -3'
(R):5'- TGCTATGGCCCACAGGAACTC -3'
Posted On2019-05-13