Mutagenetix > Incidental Mutations

Incidental Mutation 'R7063:Casr'

548415

Institutional Source

Beutler Lab

Gene Symbol

Casr

Ensembl Gene

ENSMUSG00000051980

Gene Name

calcium-sensing receptor

Synonyms

CaR, cation sensing receptor, Gprc2a

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7063 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

36493696-36562141 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 36494574 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 968 (I968V)

Ref Sequence

ENSEMBL: ENSMUSP00000110496 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063597] [ENSMUST00000114847] [ENSMUST00000172826]

Predicted Effect

probably benign
Transcript: ENSMUST00000063597
AA Change: I1045V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000069080
Gene: ENSMUSG00000051980
AA Change: I1045V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Peripla_BP_6	63	321	1e-13	PFAM
Pfam:ANF_receptor	69	495	1.1e-114	PFAM
Pfam:NCD3G	538	591	1.4e-20	PFAM
Pfam:7tm_3	624	859	7.4e-61	PFAM
low complexity region	894	920	N/A	INTRINSIC
low complexity region	930	961	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114847
AA Change: I968V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000110496
Gene: ENSMUSG00000051980
AA Change: I968V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Peripla_BP_6	63	321	2.1e-14	PFAM
Pfam:ANF_receptor	69	461	2.8e-99	PFAM
Pfam:NCD3G	461	514	1.2e-20	PFAM
Pfam:7tm_3	545	783	9.9e-87	PFAM
low complexity region	817	843	N/A	INTRINSIC
low complexity region	853	884	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172826
AA Change: I1045V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000133500
Gene: ENSMUSG00000051980
AA Change: I1045V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Peripla_BP_6	63	321	2.4e-14	PFAM
Pfam:ANF_receptor	69	495	3.9e-111	PFAM
Pfam:NCD3G	538	591	1.4e-20	PFAM
Pfam:7tm_3	622	860	1.1e-86	PFAM
low complexity region	894	920	N/A	INTRINSIC
low complexity region	930	961	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor that is expressed in the parathyroid hormone (PTH)-producing chief cells of the parathyroid gland, and the cells lining the kidney tubule. It senses small changes in circulating calcium concentration and couples this information to intracellular signaling pathways that modify PTH secretion or renal cation handling, thus this protein plays an essential role in maintaining mineral ion homeostasis. Mutations in this gene cause familial hypocalciuric hypercalcemia, familial, isolated hypoparathyroidism, and neonatal severe primary hyperparathyroidism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high levels of serum calcium and parathyroid hormone, parathyroid hyperplasia, bone defects, reduced growth, and early death. Carriers have elevated serum calcium, magnesium, and parathyroid hormone levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap35	A	G	7: 16,565,113	V9A	probably benign	Het
Btbd6	A	G	12: 112,977,512	Y148C	probably damaging	Het
C130060K24Rik	A	G	6: 65,441,403		probably benign	Het
Celf1	T	C	2: 91,012,844		probably null	Het
Chst2	G	T	9: 95,405,568	R242S	probably benign	Het
Clca3a1	T	A	3: 144,755,206	D228V	probably damaging	Het
Cwf19l2	A	G	9: 3,430,532	Y288C	probably benign	Het
Cyp2r1	A	G	7: 114,552,949	S49P	probably damaging	Het
Dnah5	A	G	15: 28,233,248	E251G	probably benign	Het
Eepd1	A	G	9: 25,483,036	R199G	possibly damaging	Het
Fat1	C	T	8: 45,040,775	T3986I	probably benign	Het
Gbp4	G	A	5: 105,118,448	R576C	probably damaging	Het
Glp1r	A	G	17: 30,925,558	Y235C	probably damaging	Het
Gm31371	G	A	8: 19,903,412	C7Y		Het
Gm6408	T	C	5: 146,483,784	I158T	probably benign	Het
Gpr89	C	G	3: 96,875,698	R312P	probably damaging	Het
Idh2	A	G	7: 80,095,684	V403A	probably damaging	Het
Lclat1	A	G	17: 73,239,991	E301G	possibly damaging	Het
Lgmn	A	G	12: 102,402,678	Y181H	probably damaging	Het
Lgr5	T	C	10: 115,456,734	Y417C	probably damaging	Het
Man1a	G	T	10: 54,030,744	N311K	probably damaging	Het
Nat10	G	A	2: 103,748,077	L228F	probably benign	Het
Olfr1417	A	G	19: 11,828,184	F281L	probably damaging	Het
Olfr1445	A	G	19: 12,884,085	D68G	probably damaging	Het
Olfr476	C	A	7: 107,968,204	A269E	probably benign	Het
Olfr958	T	G	9: 39,550,115	Y252S	possibly damaging	Het
Pcmtd2	T	A	2: 181,854,983	Y130*	probably null	Het
Rapgef5	A	G	12: 117,689,129	D62G	possibly damaging	Het
Serpina3m	A	T	12: 104,391,467	I217L	probably benign	Het
Supt16	T	C	14: 52,172,048	R802G	possibly damaging	Het
Sypl2	A	T	3: 108,217,655	M130K	probably benign	Het
Tmtc2	A	T	10: 105,348,525	L503Q	probably damaging	Het
Ubald2	A	G	11: 116,434,617	Q60R	probably benign	Het
Vav1	C	T	17: 57,311,860	Q673*	probably null	Het
Vgll2	T	C	10: 52,027,976	S312P	probably benign	Het
Vmn1r191	C	T	13: 22,178,694	A297T	probably benign	Het
Vmn1r7	T	A	6: 57,024,433	I281F	possibly damaging	Het
Vmn2r108	T	C	17: 20,481,148	Y30C	probably damaging	Het
Vmn2r16	A	G	5: 109,363,784	N619S	probably damaging	Het
Vstm5	A	G	9: 15,239,253		probably benign	Het
Zfp7	A	G	15: 76,891,719	I654V	possibly damaging	Het
Zmat2	A	G	18: 36,796,574	N129S	probably null	Het

Other mutations in Casr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Casr	APN	16	36495810	missense	probably damaging	1.00
IGL01587:Casr	APN	16	36509765	missense	probably benign
IGL02323:Casr	APN	16	36509710	missense	probably damaging	1.00
IGL02369:Casr	APN	16	36494689	missense	probably benign	0.03
IGL02514:Casr	APN	16	36500325	missense	probably damaging	1.00
IGL02547:Casr	APN	16	36515674	missense	probably benign	0.06
IGL02633:Casr	APN	16	36515655	missense	probably damaging	1.00
IGL03061:Casr	APN	16	36495888	missense	probably benign	0.07
R1163:Casr	UTSW	16	36494807	missense	probably damaging	1.00
R1539:Casr	UTSW	16	36495137	missense	probably benign	0.10
R1643:Casr	UTSW	16	36500205	missense	probably damaging	1.00
R1664:Casr	UTSW	16	36509965	nonsense	probably null
R1694:Casr	UTSW	16	36495591	missense	probably damaging	1.00
R2040:Casr	UTSW	16	36510366	missense	possibly damaging	0.79
R2092:Casr	UTSW	16	36510043	missense	possibly damaging	0.96
R2125:Casr	UTSW	16	36495252	missense	possibly damaging	0.90
R2190:Casr	UTSW	16	36495416	missense	probably damaging	1.00
R2214:Casr	UTSW	16	36515758	missense	probably damaging	1.00
R4409:Casr	UTSW	16	36500341	missense	probably benign	0.01
R4410:Casr	UTSW	16	36500341	missense	probably benign	0.01
R4591:Casr	UTSW	16	36500370	missense	probably benign	0.05
R5451:Casr	UTSW	16	36509908	missense	probably damaging	0.99
R5469:Casr	UTSW	16	36510030	missense	probably benign	0.29
R5581:Casr	UTSW	16	36494744	missense	probably benign	0.01
R5700:Casr	UTSW	16	36509617	missense	probably damaging	0.99
R6258:Casr	UTSW	16	36517609	missense	probably damaging	1.00
R6447:Casr	UTSW	16	36495545	missense	probably damaging	1.00
R6751:Casr	UTSW	16	36515588	missense	probably benign	0.00
R6938:Casr	UTSW	16	36495921	missense	probably damaging	1.00
R7313:Casr	UTSW	16	36509671	missense	probably damaging	1.00
R7789:Casr	UTSW	16	36495291	missense	probably damaging	1.00
R8013:Casr	UTSW	16	36509644	missense	probably benign	0.22
R8026:Casr	UTSW	16	36495617	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCGAGTACAGGCTTTGATG -3'
(R):5'- GCCTCAGAAGAATGCTATGGC -3'

Sequencing Primer
(F):5'- AGTACAGGCTTTGATGCACCC -3'
(R):5'- TGCTATGGCCCACAGGAACTC -3'

Posted On

2019-05-13