Mutagenetix > Incidental Mutations

Incidental Mutation 'R2092:Casr'

231876

Institutional Source

Beutler Lab

Gene Symbol

Casr

Ensembl Gene

ENSMUSG00000051980

Gene Name

calcium-sensing receptor

Synonyms

CaR, cation sensing receptor, Gprc2a

MMRRC Submission

040097-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2092 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36493696-36562141 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 36510043 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 310 (Y310N)

Ref Sequence

ENSEMBL: ENSMUSP00000133500 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063597] [ENSMUST00000114847] [ENSMUST00000172826]

AlphaFold

Q9QY96

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063597
AA Change: Y310N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000069080
Gene: ENSMUSG00000051980
AA Change: Y310N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Peripla_BP_6	63	321	1e-13	PFAM
Pfam:ANF_receptor	69	495	1.1e-114	PFAM
Pfam:NCD3G	538	591	1.4e-20	PFAM
Pfam:7tm_3	624	859	7.4e-61	PFAM
low complexity region	894	920	N/A	INTRINSIC
low complexity region	930	961	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114847
AA Change: Y310N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110496
Gene: ENSMUSG00000051980
AA Change: Y310N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Peripla_BP_6	63	321	2.1e-14	PFAM
Pfam:ANF_receptor	69	461	2.8e-99	PFAM
Pfam:NCD3G	461	514	1.2e-20	PFAM
Pfam:7tm_3	545	783	9.9e-87	PFAM
low complexity region	817	843	N/A	INTRINSIC
low complexity region	853	884	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158493

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172826
AA Change: Y310N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000133500
Gene: ENSMUSG00000051980
AA Change: Y310N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Peripla_BP_6	63	321	2.4e-14	PFAM
Pfam:ANF_receptor	69	495	3.9e-111	PFAM
Pfam:NCD3G	538	591	1.4e-20	PFAM
Pfam:7tm_3	622	860	1.1e-86	PFAM
low complexity region	894	920	N/A	INTRINSIC
low complexity region	930	961	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor that is expressed in the parathyroid hormone (PTH)-producing chief cells of the parathyroid gland, and the cells lining the kidney tubule. It senses small changes in circulating calcium concentration and couples this information to intracellular signaling pathways that modify PTH secretion or renal cation handling, thus this protein plays an essential role in maintaining mineral ion homeostasis. Mutations in this gene cause familial hypocalciuric hypercalcemia, familial, isolated hypoparathyroidism, and neonatal severe primary hyperparathyroidism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high levels of serum calcium and parathyroid hormone, parathyroid hyperplasia, bone defects, reduced growth, and early death. Carriers have elevated serum calcium, magnesium, and parathyroid hormone levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	A	6: 121,674,937	C1321*	probably null	Het
Abca8b	A	G	11: 109,966,708	F673L	possibly damaging	Het
Adam19	T	G	11: 46,060,904		probably null	Het
AI987944	T	C	7: 41,374,617	T313A	possibly damaging	Het
Akap13	A	T	7: 75,610,570	I178F	probably benign	Het
Alb	G	GA	5: 90,463,983		probably null	Het
Bod1l	A	G	5: 41,831,517	S416P	probably damaging	Het
Cela3a	T	C	4: 137,404,426	N152S	probably benign	Het
Chrdl2	T	A	7: 100,020,977	C102*	probably null	Het
Col4a4	G	A	1: 82,498,946	S554L	unknown	Het
Col6a4	T	C	9: 106,060,331	K1392R	probably damaging	Het
Dab1	T	G	4: 104,678,777	Y128D	probably damaging	Het
Dars	A	T	1: 128,374,018	M293K	probably damaging	Het
Dlec1	T	C	9: 119,121,844	F493L	possibly damaging	Het
Dmbt1	G	T	7: 131,050,018	W330L	probably damaging	Het
Dnah11	A	T	12: 118,012,716	M831K	possibly damaging	Het
Dock7	T	C	4: 99,009,308	N715S	possibly damaging	Het
Edc4	T	A	8: 105,887,528	L12Q	probably damaging	Het
Edem2	T	C	2: 155,709,049	M333V	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Fto	C	A	8: 91,409,687	Y194*	probably null	Het
Gnptab	T	G	10: 88,440,305	Y1151*	probably null	Het
Grm1	A	G	10: 10,689,225	L1113P	probably benign	Het
Hnrnpa0	T	C	13: 58,127,800	K172E	probably damaging	Het
Ifitm1	A	G	7: 140,969,514	D70G	probably damaging	Het
Irx4	C	A	13: 73,265,486	T25K	probably damaging	Het
Kif22	C	T	7: 127,033,630	D195N	probably damaging	Het
Lrp2	C	T	2: 69,536,021	D245N	probably benign	Het
Lyz1	C	T	10: 117,288,599	R144Q	probably benign	Het
Macf1	T	A	4: 123,383,178	T6055S	probably damaging	Het
Mrgpra2b	C	T	7: 47,464,160	V249I	probably benign	Het
Myh9	G	A	15: 77,764,350	Q80*	probably null	Het
Myo6	G	T	9: 80,245,682	R199L	probably damaging	Het
Naglu	G	A	11: 101,076,720	V499I	possibly damaging	Het
Nfkbie	T	C	17: 45,558,539	F140S	probably benign	Het
Olfr1208	A	G	2: 88,897,267	F110S	probably damaging	Het
Olfr1454	T	A	19: 13,063,802	Y130*	probably null	Het
Olfr510	CAAATA	CA	7: 108,667,662		probably null	Het
Olfr598	G	A	7: 103,329,109	V208M	probably damaging	Het
Olfr67	A	T	7: 103,788,072	F68L	possibly damaging	Het
Olfr935	A	T	9: 38,995,189	L82Q	probably damaging	Het
Otop1	A	T	5: 38,299,766	I290F	probably damaging	Het
P2rx2	C	T	5: 110,341,141	D203N	probably damaging	Het
Pcdhb10	T	A	18: 37,414,187	I772N	probably benign	Het
Pnliprp1	A	G	19: 58,741,184	H423R	probably benign	Het
Ptk2	A	T	15: 73,236,191	Y56*	probably null	Het
Rapgef3	T	C	15: 97,760,723	D134G	probably damaging	Het
Scaf11	A	C	15: 96,415,827	S1358A	probably damaging	Het
Scn9a	T	C	2: 66,533,376	M844V	probably damaging	Het
Sh3tc1	T	C	5: 35,700,658	E1121G	probably damaging	Het
Slc25a15	T	C	8: 22,380,934	T176A	probably damaging	Het
Slc29a4	T	A	5: 142,718,855	I384N	probably damaging	Het
Slc40a1	A	T	1: 45,909,454	D555E	probably benign	Het
Smc5	T	C	19: 23,238,899	I446V	probably benign	Het
St6gal2	T	C	17: 55,510,266	Y477H	probably damaging	Het
Syngr1	A	T	15: 80,115,940	Q84L	possibly damaging	Het
Tedc1	T	C	12: 113,157,720	L187P	probably damaging	Het
Tg	A	G	15: 66,849,607	I322V	probably null	Het
Thap12	T	C	7: 98,716,449	V608A	possibly damaging	Het
Tmbim6	T	C	15: 99,402,068	S22P	probably damaging	Het
Ttc3	C	T	16: 94,442,832	P1232S	probably benign	Het
Upk3a	A	G	15: 85,018,085	T38A	probably damaging	Het
Utrn	A	T	10: 12,678,698	M1549K	probably benign	Het
Vmn1r176	C	T	7: 23,835,153	D192N	probably damaging	Het
Vmn1r198	A	G	13: 22,354,715	T35A	possibly damaging	Het
Xkr7	C	T	2: 153,054,063	S279L	probably damaging	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp641	G	T	15: 98,293,712	T31N	probably benign	Het
Zfp74	G	A	7: 29,953,924		probably benign	Het

Other mutations in Casr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Casr	APN	16	36495810	missense	probably damaging	1.00
IGL01587:Casr	APN	16	36509765	missense	probably benign
IGL02323:Casr	APN	16	36509710	missense	probably damaging	1.00
IGL02369:Casr	APN	16	36494689	missense	probably benign	0.03
IGL02514:Casr	APN	16	36500325	missense	probably damaging	1.00
IGL02547:Casr	APN	16	36515674	missense	probably benign	0.06
IGL02633:Casr	APN	16	36515655	missense	probably damaging	1.00
IGL03061:Casr	APN	16	36495888	missense	probably benign	0.07
R1163:Casr	UTSW	16	36494807	missense	probably damaging	1.00
R1539:Casr	UTSW	16	36495137	missense	probably benign	0.10
R1643:Casr	UTSW	16	36500205	missense	probably damaging	1.00
R1664:Casr	UTSW	16	36509965	nonsense	probably null
R1694:Casr	UTSW	16	36495591	missense	probably damaging	1.00
R2040:Casr	UTSW	16	36510366	missense	possibly damaging	0.79
R2125:Casr	UTSW	16	36495252	missense	possibly damaging	0.90
R2190:Casr	UTSW	16	36495416	missense	probably damaging	1.00
R2214:Casr	UTSW	16	36515758	missense	probably damaging	1.00
R4409:Casr	UTSW	16	36500341	missense	probably benign	0.01
R4410:Casr	UTSW	16	36500341	missense	probably benign	0.01
R4591:Casr	UTSW	16	36500370	missense	probably benign	0.05
R5451:Casr	UTSW	16	36509908	missense	probably damaging	0.99
R5469:Casr	UTSW	16	36510030	missense	probably benign	0.29
R5581:Casr	UTSW	16	36494744	missense	probably benign	0.01
R5700:Casr	UTSW	16	36509617	missense	probably damaging	0.99
R6258:Casr	UTSW	16	36517609	missense	probably damaging	1.00
R6447:Casr	UTSW	16	36495545	missense	probably damaging	1.00
R6751:Casr	UTSW	16	36515588	missense	probably benign	0.00
R6938:Casr	UTSW	16	36495921	missense	probably damaging	1.00
R7063:Casr	UTSW	16	36494574	missense	probably benign	0.00
R7313:Casr	UTSW	16	36509671	missense	probably damaging	1.00
R7789:Casr	UTSW	16	36495291	missense	probably damaging	1.00
R8013:Casr	UTSW	16	36509644	missense	probably benign	0.22
R8026:Casr	UTSW	16	36495617	missense	probably damaging	1.00
R8141:Casr	UTSW	16	36494811	missense	probably damaging	1.00
R8184:Casr	UTSW	16	36509746	missense	probably benign
R8278:Casr	UTSW	16	36515649	missense	probably damaging	1.00
R8386:Casr	UTSW	16	36515588	missense	probably damaging	0.96
R8393:Casr	UTSW	16	36510204	missense	probably benign	0.02
R8682:Casr	UTSW	16	36495422	missense	possibly damaging	0.65
R9020:Casr	UTSW	16	36495249	missense	probably damaging	1.00
R9051:Casr	UTSW	16	36510052	missense	probably benign	0.00
R9260:Casr	UTSW	16	36509964	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCACGGGTAAAGGTCCTTTTG -3'
(R):5'- GACTTCAGCGAGCTCATCTC -3'

Sequencing Primer
(F):5'- AAAGGTCCTTTTGCGCCG -3'
(R):5'- TCTCCCAGTACTCTGATGAGGAAG -3'

Posted On

2014-09-18