Incidental Mutation 'R2092:Casr'
ID 231876
Institutional Source Beutler Lab
Gene Symbol Casr
Ensembl Gene ENSMUSG00000051980
Gene Name calcium-sensing receptor
Synonyms CaR, cation sensing receptor, Gprc2a
MMRRC Submission 040097-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2092 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 36493696-36562141 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36510043 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 310 (Y310N)
Ref Sequence ENSEMBL: ENSMUSP00000133500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063597] [ENSMUST00000114847] [ENSMUST00000172826]
AlphaFold Q9QY96
Predicted Effect possibly damaging
Transcript: ENSMUST00000063597
AA Change: Y310N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069080
Gene: ENSMUSG00000051980
AA Change: Y310N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Peripla_BP_6 63 321 1e-13 PFAM
Pfam:ANF_receptor 69 495 1.1e-114 PFAM
Pfam:NCD3G 538 591 1.4e-20 PFAM
Pfam:7tm_3 624 859 7.4e-61 PFAM
low complexity region 894 920 N/A INTRINSIC
low complexity region 930 961 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114847
AA Change: Y310N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110496
Gene: ENSMUSG00000051980
AA Change: Y310N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Peripla_BP_6 63 321 2.1e-14 PFAM
Pfam:ANF_receptor 69 461 2.8e-99 PFAM
Pfam:NCD3G 461 514 1.2e-20 PFAM
Pfam:7tm_3 545 783 9.9e-87 PFAM
low complexity region 817 843 N/A INTRINSIC
low complexity region 853 884 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158493
Predicted Effect possibly damaging
Transcript: ENSMUST00000172826
AA Change: Y310N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133500
Gene: ENSMUSG00000051980
AA Change: Y310N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Peripla_BP_6 63 321 2.4e-14 PFAM
Pfam:ANF_receptor 69 495 3.9e-111 PFAM
Pfam:NCD3G 538 591 1.4e-20 PFAM
Pfam:7tm_3 622 860 1.1e-86 PFAM
low complexity region 894 920 N/A INTRINSIC
low complexity region 930 961 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor that is expressed in the parathyroid hormone (PTH)-producing chief cells of the parathyroid gland, and the cells lining the kidney tubule. It senses small changes in circulating calcium concentration and couples this information to intracellular signaling pathways that modify PTH secretion or renal cation handling, thus this protein plays an essential role in maintaining mineral ion homeostasis. Mutations in this gene cause familial hypocalciuric hypercalcemia, familial, isolated hypoparathyroidism, and neonatal severe primary hyperparathyroidism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high levels of serum calcium and parathyroid hormone, parathyroid hyperplasia, bone defects, reduced growth, and early death. Carriers have elevated serum calcium, magnesium, and parathyroid hormone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,674,937 C1321* probably null Het
Abca8b A G 11: 109,966,708 F673L possibly damaging Het
Adam19 T G 11: 46,060,904 probably null Het
AI987944 T C 7: 41,374,617 T313A possibly damaging Het
Akap13 A T 7: 75,610,570 I178F probably benign Het
Alb G GA 5: 90,463,983 probably null Het
Bod1l A G 5: 41,831,517 S416P probably damaging Het
Cela3a T C 4: 137,404,426 N152S probably benign Het
Chrdl2 T A 7: 100,020,977 C102* probably null Het
Col4a4 G A 1: 82,498,946 S554L unknown Het
Col6a4 T C 9: 106,060,331 K1392R probably damaging Het
Dab1 T G 4: 104,678,777 Y128D probably damaging Het
Dars A T 1: 128,374,018 M293K probably damaging Het
Dlec1 T C 9: 119,121,844 F493L possibly damaging Het
Dmbt1 G T 7: 131,050,018 W330L probably damaging Het
Dnah11 A T 12: 118,012,716 M831K possibly damaging Het
Dock7 T C 4: 99,009,308 N715S possibly damaging Het
Edc4 T A 8: 105,887,528 L12Q probably damaging Het
Edem2 T C 2: 155,709,049 M333V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fto C A 8: 91,409,687 Y194* probably null Het
Gnptab T G 10: 88,440,305 Y1151* probably null Het
Grm1 A G 10: 10,689,225 L1113P probably benign Het
Hnrnpa0 T C 13: 58,127,800 K172E probably damaging Het
Ifitm1 A G 7: 140,969,514 D70G probably damaging Het
Irx4 C A 13: 73,265,486 T25K probably damaging Het
Kif22 C T 7: 127,033,630 D195N probably damaging Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Lyz1 C T 10: 117,288,599 R144Q probably benign Het
Macf1 T A 4: 123,383,178 T6055S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myh9 G A 15: 77,764,350 Q80* probably null Het
Myo6 G T 9: 80,245,682 R199L probably damaging Het
Naglu G A 11: 101,076,720 V499I possibly damaging Het
Nfkbie T C 17: 45,558,539 F140S probably benign Het
Olfr1208 A G 2: 88,897,267 F110S probably damaging Het
Olfr1454 T A 19: 13,063,802 Y130* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr598 G A 7: 103,329,109 V208M probably damaging Het
Olfr67 A T 7: 103,788,072 F68L possibly damaging Het
Olfr935 A T 9: 38,995,189 L82Q probably damaging Het
Otop1 A T 5: 38,299,766 I290F probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Pcdhb10 T A 18: 37,414,187 I772N probably benign Het
Pnliprp1 A G 19: 58,741,184 H423R probably benign Het
Ptk2 A T 15: 73,236,191 Y56* probably null Het
Rapgef3 T C 15: 97,760,723 D134G probably damaging Het
Scaf11 A C 15: 96,415,827 S1358A probably damaging Het
Scn9a T C 2: 66,533,376 M844V probably damaging Het
Sh3tc1 T C 5: 35,700,658 E1121G probably damaging Het
Slc25a15 T C 8: 22,380,934 T176A probably damaging Het
Slc29a4 T A 5: 142,718,855 I384N probably damaging Het
Slc40a1 A T 1: 45,909,454 D555E probably benign Het
Smc5 T C 19: 23,238,899 I446V probably benign Het
St6gal2 T C 17: 55,510,266 Y477H probably damaging Het
Syngr1 A T 15: 80,115,940 Q84L possibly damaging Het
Tedc1 T C 12: 113,157,720 L187P probably damaging Het
Tg A G 15: 66,849,607 I322V probably null Het
Thap12 T C 7: 98,716,449 V608A possibly damaging Het
Tmbim6 T C 15: 99,402,068 S22P probably damaging Het
Ttc3 C T 16: 94,442,832 P1232S probably benign Het
Upk3a A G 15: 85,018,085 T38A probably damaging Het
Utrn A T 10: 12,678,698 M1549K probably benign Het
Vmn1r176 C T 7: 23,835,153 D192N probably damaging Het
Vmn1r198 A G 13: 22,354,715 T35A possibly damaging Het
Xkr7 C T 2: 153,054,063 S279L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp641 G T 15: 98,293,712 T31N probably benign Het
Zfp74 G A 7: 29,953,924 probably benign Het
Other mutations in Casr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Casr APN 16 36495810 missense probably damaging 1.00
IGL01587:Casr APN 16 36509765 missense probably benign
IGL02323:Casr APN 16 36509710 missense probably damaging 1.00
IGL02369:Casr APN 16 36494689 missense probably benign 0.03
IGL02514:Casr APN 16 36500325 missense probably damaging 1.00
IGL02547:Casr APN 16 36515674 missense probably benign 0.06
IGL02633:Casr APN 16 36515655 missense probably damaging 1.00
IGL03061:Casr APN 16 36495888 missense probably benign 0.07
R1163:Casr UTSW 16 36494807 missense probably damaging 1.00
R1539:Casr UTSW 16 36495137 missense probably benign 0.10
R1643:Casr UTSW 16 36500205 missense probably damaging 1.00
R1664:Casr UTSW 16 36509965 nonsense probably null
R1694:Casr UTSW 16 36495591 missense probably damaging 1.00
R2040:Casr UTSW 16 36510366 missense possibly damaging 0.79
R2125:Casr UTSW 16 36495252 missense possibly damaging 0.90
R2190:Casr UTSW 16 36495416 missense probably damaging 1.00
R2214:Casr UTSW 16 36515758 missense probably damaging 1.00
R4409:Casr UTSW 16 36500341 missense probably benign 0.01
R4410:Casr UTSW 16 36500341 missense probably benign 0.01
R4591:Casr UTSW 16 36500370 missense probably benign 0.05
R5451:Casr UTSW 16 36509908 missense probably damaging 0.99
R5469:Casr UTSW 16 36510030 missense probably benign 0.29
R5581:Casr UTSW 16 36494744 missense probably benign 0.01
R5700:Casr UTSW 16 36509617 missense probably damaging 0.99
R6258:Casr UTSW 16 36517609 missense probably damaging 1.00
R6447:Casr UTSW 16 36495545 missense probably damaging 1.00
R6751:Casr UTSW 16 36515588 missense probably benign 0.00
R6938:Casr UTSW 16 36495921 missense probably damaging 1.00
R7063:Casr UTSW 16 36494574 missense probably benign 0.00
R7313:Casr UTSW 16 36509671 missense probably damaging 1.00
R7789:Casr UTSW 16 36495291 missense probably damaging 1.00
R8013:Casr UTSW 16 36509644 missense probably benign 0.22
R8026:Casr UTSW 16 36495617 missense probably damaging 1.00
R8141:Casr UTSW 16 36494811 missense probably damaging 1.00
R8184:Casr UTSW 16 36509746 missense probably benign
R8278:Casr UTSW 16 36515649 missense probably damaging 1.00
R8386:Casr UTSW 16 36515588 missense probably damaging 0.96
R8393:Casr UTSW 16 36510204 missense probably benign 0.02
R8682:Casr UTSW 16 36495422 missense possibly damaging 0.65
R9020:Casr UTSW 16 36495249 missense probably damaging 1.00
R9051:Casr UTSW 16 36510052 missense probably benign 0.00
R9260:Casr UTSW 16 36509964 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCACGGGTAAAGGTCCTTTTG -3'
(R):5'- GACTTCAGCGAGCTCATCTC -3'

Sequencing Primer
(F):5'- AAAGGTCCTTTTGCGCCG -3'
(R):5'- TCTCCCAGTACTCTGATGAGGAAG -3'
Posted On 2014-09-18