Incidental Mutation 'R7063:Rapgef5'
ID548410
Institutional Source Beutler Lab
Gene Symbol Rapgef5
Ensembl Gene ENSMUSG00000041992
Gene NameRap guanine nucleotide exchange factor (GEF) 5
SynonymsD030051B22Rik, mr-gef
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7063 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location117516479-117759737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117689129 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 62 (D62G)
Ref Sequence ENSEMBL: ENSMUSP00000152339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109691] [ENSMUST00000222105] [ENSMUST00000222185]
Predicted Effect probably benign
Transcript: ENSMUST00000109691
SMART Domains Protein: ENSMUSP00000105313
Gene: ENSMUSG00000041992

DomainStartEndE-ValueType
DEP 44 118 2.07e-12 SMART
RasGEFN 300 434 3.12e-34 SMART
Blast:RasGEF 441 502 7e-31 BLAST
RasGEF 574 814 1.52e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222105
Predicted Effect possibly damaging
Transcript: ENSMUST00000222185
AA Change: D62G

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF5, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A G 7: 16,565,113 V9A probably benign Het
Btbd6 A G 12: 112,977,512 Y148C probably damaging Het
C130060K24Rik A G 6: 65,441,403 probably benign Het
Casr T C 16: 36,494,574 I968V probably benign Het
Celf1 T C 2: 91,012,844 probably null Het
Chst2 G T 9: 95,405,568 R242S probably benign Het
Clca3a1 T A 3: 144,755,206 D228V probably damaging Het
Cwf19l2 A G 9: 3,430,532 Y288C probably benign Het
Cyp2r1 A G 7: 114,552,949 S49P probably damaging Het
Dnah5 A G 15: 28,233,248 E251G probably benign Het
Eepd1 A G 9: 25,483,036 R199G possibly damaging Het
Fat1 C T 8: 45,040,775 T3986I probably benign Het
Gbp4 G A 5: 105,118,448 R576C probably damaging Het
Glp1r A G 17: 30,925,558 Y235C probably damaging Het
Gm31371 G A 8: 19,903,412 C7Y Het
Gm6408 T C 5: 146,483,784 I158T probably benign Het
Gpr89 C G 3: 96,875,698 R312P probably damaging Het
Idh2 A G 7: 80,095,684 V403A probably damaging Het
Lclat1 A G 17: 73,239,991 E301G possibly damaging Het
Lgmn A G 12: 102,402,678 Y181H probably damaging Het
Lgr5 T C 10: 115,456,734 Y417C probably damaging Het
Man1a G T 10: 54,030,744 N311K probably damaging Het
Nat10 G A 2: 103,748,077 L228F probably benign Het
Olfr1417 A G 19: 11,828,184 F281L probably damaging Het
Olfr1445 A G 19: 12,884,085 D68G probably damaging Het
Olfr476 C A 7: 107,968,204 A269E probably benign Het
Olfr958 T G 9: 39,550,115 Y252S possibly damaging Het
Pcmtd2 T A 2: 181,854,983 Y130* probably null Het
Serpina3m A T 12: 104,391,467 I217L probably benign Het
Supt16 T C 14: 52,172,048 R802G possibly damaging Het
Sypl2 A T 3: 108,217,655 M130K probably benign Het
Tmtc2 A T 10: 105,348,525 L503Q probably damaging Het
Ubald2 A G 11: 116,434,617 Q60R probably benign Het
Vav1 C T 17: 57,311,860 Q673* probably null Het
Vgll2 T C 10: 52,027,976 S312P probably benign Het
Vmn1r191 C T 13: 22,178,694 A297T probably benign Het
Vmn1r7 T A 6: 57,024,433 I281F possibly damaging Het
Vmn2r108 T C 17: 20,481,148 Y30C probably damaging Het
Vmn2r16 A G 5: 109,363,784 N619S probably damaging Het
Vstm5 A G 9: 15,239,253 probably benign Het
Zfp7 A G 15: 76,891,719 I654V possibly damaging Het
Zmat2 A G 18: 36,796,574 N129S probably null Het
Other mutations in Rapgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Rapgef5 APN 12 117714182 missense probably damaging 0.99
IGL01405:Rapgef5 APN 12 117721380 missense probably benign 0.16
IGL01611:Rapgef5 APN 12 117753419 splice site probably benign
IGL01720:Rapgef5 APN 12 117613435 splice site probably benign
IGL01958:Rapgef5 APN 12 117730651 missense probably benign 0.24
IGL02093:Rapgef5 APN 12 117719132 missense probably damaging 0.98
IGL03210:Rapgef5 APN 12 117742872 missense probably damaging 1.00
IGL03370:Rapgef5 APN 12 117730559 missense probably damaging 1.00
IGL03397:Rapgef5 APN 12 117748441 missense probably damaging 1.00
R0026:Rapgef5 UTSW 12 117689161 missense probably benign 0.11
R0026:Rapgef5 UTSW 12 117689161 missense probably benign 0.11
R0100:Rapgef5 UTSW 12 117721299 missense probably benign 0.05
R0173:Rapgef5 UTSW 12 117688676 missense probably benign 0.00
R0834:Rapgef5 UTSW 12 117647121 splice site probably benign
R1331:Rapgef5 UTSW 12 117721349 missense probably benign 0.04
R1505:Rapgef5 UTSW 12 117688619 missense possibly damaging 0.92
R1546:Rapgef5 UTSW 12 117647101 missense probably benign 0.00
R1577:Rapgef5 UTSW 12 117595291 missense probably benign 0.28
R1597:Rapgef5 UTSW 12 117658320 missense probably damaging 1.00
R1824:Rapgef5 UTSW 12 117688684 critical splice donor site probably null
R2065:Rapgef5 UTSW 12 117584119 nonsense probably null
R2117:Rapgef5 UTSW 12 117714064 intron probably null
R2169:Rapgef5 UTSW 12 117715395 missense probably benign 0.25
R2903:Rapgef5 UTSW 12 117714119 missense probably damaging 1.00
R3983:Rapgef5 UTSW 12 117728670 missense possibly damaging 0.49
R4004:Rapgef5 UTSW 12 117748397 missense probably damaging 0.99
R4652:Rapgef5 UTSW 12 117714128 missense probably damaging 0.99
R4830:Rapgef5 UTSW 12 117756074 missense probably damaging 1.00
R5282:Rapgef5 UTSW 12 117739644 missense probably damaging 1.00
R5348:Rapgef5 UTSW 12 117688611 missense probably benign 0.24
R5456:Rapgef5 UTSW 12 117728646 splice site probably null
R5502:Rapgef5 UTSW 12 117721329 missense probably damaging 1.00
R5741:Rapgef5 UTSW 12 117756029 missense probably damaging 0.99
R5771:Rapgef5 UTSW 12 117721326 missense probably benign 0.45
R5905:Rapgef5 UTSW 12 117748426 missense probably damaging 1.00
R5941:Rapgef5 UTSW 12 117728738 missense probably damaging 1.00
R6228:Rapgef5 UTSW 12 117721663 intron probably null
R6233:Rapgef5 UTSW 12 117739718 critical splice donor site probably null
R6376:Rapgef5 UTSW 12 117721253 missense probably damaging 1.00
R6475:Rapgef5 UTSW 12 117718207 missense probably damaging 1.00
R7410:Rapgef5 UTSW 12 117721328 missense probably damaging 1.00
R7445:Rapgef5 UTSW 12 117755969 missense probably benign 0.00
R7690:Rapgef5 UTSW 12 117721370 missense possibly damaging 0.72
R7707:Rapgef5 UTSW 12 117715344 missense probably damaging 1.00
R7815:Rapgef5 UTSW 12 117755967 missense probably benign 0.10
X0018:Rapgef5 UTSW 12 117718215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTTCACAATGGGCAGCTC -3'
(R):5'- AGCTTAGCTCCTGGGGATAC -3'

Sequencing Primer
(F):5'- CCCGCTTGCGGGTCTTTG -3'
(R):5'- CTTAGCTCCTGGGGATACTGACAG -3'
Posted On2019-05-13