Incidental Mutation 'R7115:Vmn2r44'
ID 551724
Institutional Source Beutler Lab
Gene Symbol Vmn2r44
Ensembl Gene ENSMUSG00000094098
Gene Name vomeronasal 2, receptor 44
Synonyms EG434113
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock # R7115 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 8366502-8383354 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 8367528 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 840 (R840*)
Ref Sequence ENSEMBL: ENSMUSP00000132467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166499]
AlphaFold L7N2E1
Predicted Effect probably null
Transcript: ENSMUST00000166499
AA Change: R840*
SMART Domains Protein: ENSMUSP00000132467
Gene: ENSMUSG00000094098
AA Change: R840*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-34 PFAM
Pfam:NCD3G 512 565 3.8e-20 PFAM
Pfam:7tm_3 598 833 5.7e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,437,725 I636N probably benign Het
Adam5 A G 8: 24,781,696 I565T possibly damaging Het
Amd2 C A 10: 35,711,637 probably benign Het
Ap5m1 T A 14: 49,086,270 Y472* probably null Het
Apcdd1 T C 18: 62,936,953 F97S probably damaging Het
Axdnd1 T C 1: 156,380,876 K267R Het
BC067074 T G 13: 113,320,776 S1119A Het
Carf G T 1: 60,148,150 L637F probably damaging Het
Ccdc103 A T 11: 102,883,810 S95C possibly damaging Het
Cfap20 T C 8: 95,421,246 I156V probably benign Het
Csn1s2a T C 5: 87,781,805 C96R probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dennd2a G A 6: 39,506,711 T405M probably damaging Het
Dennd5a A G 7: 109,894,754 Y1248H probably damaging Het
Dnah14 A T 1: 181,720,145 K2504N probably damaging Het
Dnajb2 G A 1: 75,243,662 G275D Het
Elf3 T G 1: 135,257,118 D110A probably damaging Het
Eomes A G 9: 118,484,489 N534S probably benign Het
Fry A T 5: 150,386,067 R659W probably damaging Het
Gm10428 G A 11: 62,753,380 C94Y unknown Het
Gm2696 T A 10: 77,836,299 C111S unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Lrp1b T A 2: 40,998,235 N2338Y Het
Map2k1 A G 9: 64,212,606 I139T probably damaging Het
Olfr44 T C 9: 39,484,648 I202V probably benign Het
Olfr964-ps1 T C 9: 39,686,707 Y79C probably benign Het
Pxylp1 G A 9: 96,825,010 T373I probably benign Het
Ranbp9 T C 13: 43,406,671 N484S probably benign Het
Rassf5 A G 1: 131,181,249 V293A probably benign Het
Ring1 A G 17: 34,023,446 I29T probably damaging Het
Scn1a G A 2: 66,324,618 Q666* probably null Het
Spice1 G A 16: 44,379,275 G697R probably benign Het
Tas2r131 A G 6: 132,957,604 F81L probably benign Het
Tenm2 G A 11: 36,163,817 S572L probably damaging Het
Tfr2 A G 5: 137,571,715 T128A probably benign Het
Trim56 T A 5: 137,113,660 Q334L probably damaging Het
Other mutations in Vmn2r44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Vmn2r44 APN 7 8380104 critical splice donor site probably null
IGL01723:Vmn2r44 APN 7 8377916 missense probably damaging 0.97
IGL01767:Vmn2r44 APN 7 8380238 missense probably benign 0.00
IGL02161:Vmn2r44 APN 7 8377815 missense possibly damaging 0.94
IGL02299:Vmn2r44 APN 7 8377816 missense probably benign
IGL02418:Vmn2r44 APN 7 8377865 missense probably damaging 1.00
IGL02829:Vmn2r44 APN 7 8377880 missense possibly damaging 0.94
IGL02851:Vmn2r44 APN 7 8383051 missense probably damaging 1.00
IGL03080:Vmn2r44 APN 7 8383245 utr 5 prime probably benign
R1471:Vmn2r44 UTSW 7 8377883 missense probably damaging 0.99
R1789:Vmn2r44 UTSW 7 8380123 missense possibly damaging 0.64
R1932:Vmn2r44 UTSW 7 8367982 missense probably benign 0.04
R2354:Vmn2r44 UTSW 7 8370640 missense probably damaging 0.99
R4009:Vmn2r44 UTSW 7 8377988 missense possibly damaging 0.82
R4130:Vmn2r44 UTSW 7 8367919 missense probably damaging 1.00
R4790:Vmn2r44 UTSW 7 8367950 missense probably damaging 1.00
R4854:Vmn2r44 UTSW 7 8380301 missense possibly damaging 0.94
R4887:Vmn2r44 UTSW 7 8377986 missense probably benign 0.19
R4888:Vmn2r44 UTSW 7 8377986 missense probably benign 0.19
R5484:Vmn2r44 UTSW 7 8380124 missense possibly damaging 0.69
R6110:Vmn2r44 UTSW 7 8378006 missense probably damaging 1.00
R6357:Vmn2r44 UTSW 7 8370658 missense probably benign 0.01
R6526:Vmn2r44 UTSW 7 8378099 missense probably benign 0.01
R7083:Vmn2r44 UTSW 7 8378370 missense probably benign 0.44
R7087:Vmn2r44 UTSW 7 8378367 missense probably benign 0.02
R7125:Vmn2r44 UTSW 7 8367942 missense probably damaging 1.00
R7258:Vmn2r44 UTSW 7 8377849 missense probably damaging 1.00
R7359:Vmn2r44 UTSW 7 8367539 missense probably benign 0.30
R7494:Vmn2r44 UTSW 7 8383123 nonsense probably null
R7766:Vmn2r44 UTSW 7 8368220 missense probably damaging 1.00
R7777:Vmn2r44 UTSW 7 8378315 missense possibly damaging 0.81
R8184:Vmn2r44 UTSW 7 8368228 nonsense probably null
R8674:Vmn2r44 UTSW 7 8377823 missense probably damaging 1.00
R8752:Vmn2r44 UTSW 7 8367806 missense probably damaging 1.00
R8897:Vmn2r44 UTSW 7 8378243 missense probably damaging 1.00
R8915:Vmn2r44 UTSW 7 8367651 missense probably damaging 1.00
R8928:Vmn2r44 UTSW 7 8378102 missense probably damaging 1.00
R9163:Vmn2r44 UTSW 7 8368092 missense probably benign 0.00
Z1177:Vmn2r44 UTSW 7 8367977 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACTAGAGCAACCAGTGAGAATG -3'
(R):5'- CTTGGCCAAGAATCTGCCTG -3'

Sequencing Primer
(F):5'- CAACCAGTGAGAATGAGTCTAAAAC -3'
(R):5'- GAAGCCAAGTTCTTGACCTTCAG -3'
Posted On 2019-05-15