Incidental Mutation 'R7115:Elf3'
ID 551713
Institutional Source Beutler Lab
Gene Symbol Elf3
Ensembl Gene ENSMUSG00000003051
Gene Name E74-like factor 3
Synonyms ESE-1, jen, ESX
MMRRC Submission 045206-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.925) question?
Stock # R7115 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 135181312-135186210 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 135184856 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 110 (D110A)
Ref Sequence ENSEMBL: ENSMUSP00000003135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003135] [ENSMUST00000185752]
AlphaFold Q3UPW2
PDB Structure Crystal structure of mouse Elf3 C-terminal DNA-binding domain in complex with type II TGF-beta receptor promoter DNA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000003135
AA Change: D110A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000003135
Gene: ENSMUSG00000003051
AA Change: D110A

DomainStartEndE-ValueType
SAM_PNT 67 151 6.32e-30 SMART
low complexity region 230 241 N/A INTRINSIC
AT_hook 264 276 1.29e0 SMART
ETS 292 379 6.11e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185752
AA Change: D90A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139769
Gene: ENSMUSG00000003051
AA Change: D90A

DomainStartEndE-ValueType
SAM_PNT 47 131 1.36e-29 SMART
low complexity region 210 221 N/A INTRINSIC
AT_hook 244 256 1.29e0 SMART
ETS 272 359 6.11e-49 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: About one third of mice homozygous for a reporter allele die at E11.5; over half of those born develop a wasted phenotype, lethargy and watery diarrhea and die during the first few weeks of life exhibiting dysmorphogenesis and altered differentiation of small intestinal epithelium. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,255,589 (GRCm39) I636N probably benign Het
Adam5 A G 8: 25,271,712 (GRCm39) I565T possibly damaging Het
Amd2 C A 10: 35,587,633 (GRCm39) probably benign Het
Ap5m1 T A 14: 49,323,727 (GRCm39) Y472* probably null Het
Apcdd1 T C 18: 63,070,024 (GRCm39) F97S probably damaging Het
Axdnd1 T C 1: 156,208,446 (GRCm39) K267R Het
Carf G T 1: 60,187,309 (GRCm39) L637F probably damaging Het
Ccdc103 A T 11: 102,774,636 (GRCm39) S95C possibly damaging Het
Cfap20 T C 8: 96,147,874 (GRCm39) I156V probably benign Het
Csn1s2a T C 5: 87,929,664 (GRCm39) C96R probably benign Het
Cspg4b T G 13: 113,457,310 (GRCm39) S1119A Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,604,874 (GRCm39) probably benign Het
Dennd2a G A 6: 39,483,645 (GRCm39) T405M probably damaging Het
Dennd5a A G 7: 109,493,961 (GRCm39) Y1248H probably damaging Het
Dnah14 A T 1: 181,547,710 (GRCm39) K2504N probably damaging Het
Dnajb2 G A 1: 75,220,306 (GRCm39) G275D Het
Eomes A G 9: 118,313,557 (GRCm39) N534S probably benign Het
Fry A T 5: 150,309,532 (GRCm39) R659W probably damaging Het
Gm10428 G A 11: 62,644,206 (GRCm39) C94Y unknown Het
Gm2696 T A 10: 77,672,133 (GRCm39) C111S unknown Het
Gpt2 G A 8: 86,244,681 (GRCm39) E325K probably benign Het
Lrp1b T A 2: 40,888,247 (GRCm39) N2338Y Het
Map2k1 A G 9: 64,119,888 (GRCm39) I139T probably damaging Het
Or10n7-ps1 T C 9: 39,598,003 (GRCm39) Y79C probably benign Het
Or8g20 T C 9: 39,395,944 (GRCm39) I202V probably benign Het
Pxylp1 G A 9: 96,707,063 (GRCm39) T373I probably benign Het
Ranbp9 T C 13: 43,560,147 (GRCm39) N484S probably benign Het
Rassf5 A G 1: 131,108,986 (GRCm39) V293A probably benign Het
Ring1 A G 17: 34,242,420 (GRCm39) I29T probably damaging Het
Scn1a G A 2: 66,154,962 (GRCm39) Q666* probably null Het
Spice1 G A 16: 44,199,638 (GRCm39) G697R probably benign Het
Tas2r131 A G 6: 132,934,567 (GRCm39) F81L probably benign Het
Tenm2 G A 11: 36,054,644 (GRCm39) S572L probably damaging Het
Tfr2 A G 5: 137,569,977 (GRCm39) T128A probably benign Het
Trim56 T A 5: 137,142,514 (GRCm39) Q334L probably damaging Het
Vmn2r44 T A 7: 8,370,527 (GRCm39) R840* probably null Het
Other mutations in Elf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Elf3 APN 1 135,185,445 (GRCm39) missense possibly damaging 0.94
IGL02470:Elf3 APN 1 135,182,750 (GRCm39) missense probably damaging 1.00
IGL03018:Elf3 APN 1 135,183,803 (GRCm39) missense possibly damaging 0.62
IGL03252:Elf3 APN 1 135,182,691 (GRCm39) missense probably damaging 1.00
P0026:Elf3 UTSW 1 135,183,711 (GRCm39) critical splice donor site probably null
R0087:Elf3 UTSW 1 135,184,875 (GRCm39) missense probably damaging 1.00
R1842:Elf3 UTSW 1 135,184,531 (GRCm39) missense possibly damaging 0.65
R1897:Elf3 UTSW 1 135,184,875 (GRCm39) missense probably damaging 1.00
R2081:Elf3 UTSW 1 135,184,814 (GRCm39) missense probably benign 0.12
R4049:Elf3 UTSW 1 135,182,015 (GRCm39) missense probably benign 0.21
R4467:Elf3 UTSW 1 135,184,582 (GRCm39) missense probably damaging 1.00
R4630:Elf3 UTSW 1 135,184,478 (GRCm39) intron probably benign
R4715:Elf3 UTSW 1 135,185,490 (GRCm39) missense probably damaging 1.00
R4923:Elf3 UTSW 1 135,184,473 (GRCm39) intron probably benign
R5226:Elf3 UTSW 1 135,184,977 (GRCm39) missense probably benign 0.07
R5422:Elf3 UTSW 1 135,182,778 (GRCm39) missense probably damaging 0.98
R5706:Elf3 UTSW 1 135,184,220 (GRCm39) missense probably benign 0.01
R7644:Elf3 UTSW 1 135,184,244 (GRCm39) missense possibly damaging 0.89
R7855:Elf3 UTSW 1 135,182,090 (GRCm39) missense probably damaging 1.00
R7940:Elf3 UTSW 1 135,184,866 (GRCm39) missense probably damaging 1.00
R8315:Elf3 UTSW 1 135,184,314 (GRCm39) missense probably benign 0.00
R8723:Elf3 UTSW 1 135,185,385 (GRCm39) missense possibly damaging 0.95
R8724:Elf3 UTSW 1 135,182,098 (GRCm39) missense probably damaging 1.00
R8906:Elf3 UTSW 1 135,182,678 (GRCm39) missense probably damaging 1.00
R8960:Elf3 UTSW 1 135,182,813 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGTCACTGACCATGGTTC -3'
(R):5'- GTTGTGTAGGACCTCAGACAAG -3'

Sequencing Primer
(F):5'- ACTGACCATGGTTCCGGCAG -3'
(R):5'- GTGTAGGACCTCAGACAAGATCCC -3'
Posted On 2019-05-15