Incidental Mutation 'R7115:Elf3'
ID551713
Institutional Source Beutler Lab
Gene Symbol Elf3
Ensembl Gene ENSMUSG00000003051
Gene NameE74-like factor 3
SynonymsESX, jen, ESE-1
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001163131.1, NM_007921.3; MGI:1101781

Is this an essential gene? Probably essential (E-score: 0.861) question?
Stock #R7115 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location135253575-135258568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 135257118 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 110 (D110A)
Ref Sequence ENSEMBL: ENSMUSP00000003135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003135] [ENSMUST00000185752]
PDB Structure
Crystal structure of mouse Elf3 C-terminal DNA-binding domain in complex with type II TGF-beta receptor promoter DNA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000003135
AA Change: D110A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000003135
Gene: ENSMUSG00000003051
AA Change: D110A

DomainStartEndE-ValueType
SAM_PNT 67 151 6.32e-30 SMART
low complexity region 230 241 N/A INTRINSIC
AT_hook 264 276 1.29e0 SMART
ETS 292 379 6.11e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185752
AA Change: D90A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139769
Gene: ENSMUSG00000003051
AA Change: D90A

DomainStartEndE-ValueType
SAM_PNT 47 131 1.36e-29 SMART
low complexity region 210 221 N/A INTRINSIC
AT_hook 244 256 1.29e0 SMART
ETS 272 359 6.11e-49 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype Strain: 2662485
Lethality: D11-D21
PHENOTYPE: About one third of mice homozygous for a reporter allele die at E11.5; over half of those born develop a wasted phenotype, lethargy and watery diarrhea and die during the first few weeks of life exhibiting dysmorphogenesis and altered differentiation of small intestinal epithelium. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,437,725 I636N probably benign Het
Adam5 A G 8: 24,781,696 I565T possibly damaging Het
Amd2 C A 10: 35,711,637 probably benign Het
Ap5m1 T A 14: 49,086,270 Y472* probably null Het
Apcdd1 T C 18: 62,936,953 F97S probably damaging Het
Axdnd1 T C 1: 156,380,876 K267R Het
BC067074 T G 13: 113,320,776 S1119A Het
Carf G T 1: 60,148,150 L637F probably damaging Het
Ccdc103 A T 11: 102,883,810 S95C possibly damaging Het
Cfap20 T C 8: 95,421,246 I156V probably benign Het
Csn1s2a T C 5: 87,781,805 C96R probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dennd2a G A 6: 39,506,711 T405M probably damaging Het
Dennd5a A G 7: 109,894,754 Y1248H probably damaging Het
Dnah14 A T 1: 181,720,145 K2504N probably damaging Het
Dnajb2 G A 1: 75,243,662 G275D Het
Eomes A G 9: 118,484,489 N534S probably benign Het
Fry A T 5: 150,386,067 R659W probably damaging Het
Gm10428 G A 11: 62,753,380 C94Y unknown Het
Gm2696 T A 10: 77,836,299 C111S unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Lrp1b T A 2: 40,998,235 N2338Y Het
Map2k1 A G 9: 64,212,606 I139T probably damaging Het
Olfr44 T C 9: 39,484,648 I202V probably benign Het
Olfr964-ps1 T C 9: 39,686,707 Y79C probably benign Het
Pxylp1 G A 9: 96,825,010 T373I probably benign Het
Ranbp9 T C 13: 43,406,671 N484S probably benign Het
Rassf5 A G 1: 131,181,249 V293A probably benign Het
Ring1 A G 17: 34,023,446 I29T probably damaging Het
Scn1a G A 2: 66,324,618 Q666* probably null Het
Spice1 G A 16: 44,379,275 G697R probably benign Het
Tas2r131 A G 6: 132,957,604 F81L probably benign Het
Tenm2 G A 11: 36,163,817 S572L probably damaging Het
Tfr2 A G 5: 137,571,715 T128A probably benign Het
Trim56 T A 5: 137,113,660 Q334L probably damaging Het
Vmn2r44 T A 7: 8,367,528 R840* probably null Het
Other mutations in Elf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Elf3 APN 1 135257707 missense possibly damaging 0.94
IGL02470:Elf3 APN 1 135255012 missense probably damaging 1.00
IGL03018:Elf3 APN 1 135256065 missense possibly damaging 0.62
IGL03252:Elf3 APN 1 135254953 missense probably damaging 1.00
P0026:Elf3 UTSW 1 135255973 critical splice donor site probably null
R0087:Elf3 UTSW 1 135257137 missense probably damaging 1.00
R1842:Elf3 UTSW 1 135256793 missense possibly damaging 0.65
R1897:Elf3 UTSW 1 135257137 missense probably damaging 1.00
R2081:Elf3 UTSW 1 135257076 missense probably benign 0.12
R4049:Elf3 UTSW 1 135254277 missense probably benign 0.21
R4467:Elf3 UTSW 1 135256844 missense probably damaging 1.00
R4630:Elf3 UTSW 1 135256740 intron probably benign
R4715:Elf3 UTSW 1 135257752 missense probably damaging 1.00
R4923:Elf3 UTSW 1 135256735 intron probably benign
R5226:Elf3 UTSW 1 135257239 missense probably benign 0.07
R5422:Elf3 UTSW 1 135255040 missense probably damaging 0.98
R5706:Elf3 UTSW 1 135256482 missense probably benign 0.01
R7644:Elf3 UTSW 1 135256506 missense possibly damaging 0.89
R7855:Elf3 UTSW 1 135254352 missense probably damaging 1.00
R7940:Elf3 UTSW 1 135257128 missense probably damaging 1.00
R8315:Elf3 UTSW 1 135256576 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCGTCACTGACCATGGTTC -3'
(R):5'- GTTGTGTAGGACCTCAGACAAG -3'

Sequencing Primer
(F):5'- ACTGACCATGGTTCCGGCAG -3'
(R):5'- GTGTAGGACCTCAGACAAGATCCC -3'
Posted On2019-05-15