Incidental Mutation 'PIT4687001:Sugp2'
ID556190
Institutional Source Beutler Lab
Gene Symbol Sugp2
Ensembl Gene ENSMUSG00000036054
Gene NameSURP and G patch domain containing 2
SynonymsSrsf14, Sfrs14
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #PIT4687001 (G1)
Quality Score90.0077
Status Not validated
Chromosome8
Chromosomal Location70234226-70279915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70257512 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 928 (S928P)
Ref Sequence ENSEMBL: ENSMUSP00000091167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093458] [ENSMUST00000131489] [ENSMUST00000164403]
Predicted Effect probably damaging
Transcript: ENSMUST00000093458
AA Change: S928P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091167
Gene: ENSMUSG00000036054
AA Change: S928P

DomainStartEndE-ValueType
SWAP 570 622 3.74e-2 SMART
SWAP 768 822 1.12e-14 SMART
low complexity region 859 888 N/A INTRINSIC
G_patch 994 1040 1.13e-16 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000118748
Gene: ENSMUSG00000036054
AA Change: S104P

DomainStartEndE-ValueType
low complexity region 36 65 N/A INTRINSIC
G_patch 171 217 1.13e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131489
AA Change: S928P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114833
Gene: ENSMUSG00000036054
AA Change: S928P

DomainStartEndE-ValueType
SWAP 570 622 3.74e-2 SMART
SWAP 768 822 1.12e-14 SMART
low complexity region 859 888 N/A INTRINSIC
G_patch 994 1040 1.13e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164403
AA Change: S928P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128029
Gene: ENSMUSG00000036054
AA Change: S928P

DomainStartEndE-ValueType
SWAP 570 622 3.74e-2 SMART
SWAP 768 822 1.12e-14 SMART
low complexity region 859 888 N/A INTRINSIC
G_patch 994 1040 1.13e-16 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arginine/serine-rich family of splicing factors. The encoded protein functions in mRNA processing. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T G 3: 138,289,835 V333G probably damaging Het
Aggf1 A G 13: 95,364,875 L333P probably damaging Het
Ankmy1 A G 1: 92,885,081 V502A probably benign Het
Atm A G 9: 53,486,812 probably null Het
Ccdc180 A G 4: 45,949,526 T1594A probably damaging Het
Cep290 T A 10: 100,537,591 D1244E probably benign Het
Ctnna3 A G 10: 64,834,606 D638G probably damaging Het
Ctsr T C 13: 61,160,532 H266R possibly damaging Het
D630045J12Rik C T 6: 38,195,101 E711K probably benign Het
Dnah5 T C 15: 28,383,577 S2982P probably damaging Het
Dsg1a G T 18: 20,331,698 A417S probably benign Het
Gdpd1 T C 11: 87,059,540 D69G probably damaging Het
Gm13103 C T 4: 143,846,533 probably benign Het
Gp2 C T 7: 119,451,578 R310H possibly damaging Het
Ifna2 G A 4: 88,683,305 H159Y possibly damaging Het
Kptn T C 7: 16,125,826 V325A probably damaging Het
March7 A G 2: 60,232,278 E143G probably damaging Het
Mcm4 A G 16: 15,636,713 L47P probably benign Het
Mcm8 T C 2: 132,817,177 F27S possibly damaging Het
Nod2 T A 8: 88,681,646 V967E probably damaging Het
Nrxn2 G A 19: 6,481,308 R659Q probably benign Het
Olfr120 T G 17: 37,726,191 C56G probably benign Het
Olfr1267-ps1 A G 2: 90,086,389 V24A probably benign Het
Parp10 C T 15: 76,240,922 R545Q probably benign Het
Ppp2r3a T C 9: 101,144,380 E332G probably benign Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Qsox2 G A 2: 26,222,288 L81F possibly damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Spata31 A G 13: 64,921,337 D433G probably benign Het
Stpg2 T C 3: 139,215,265 I77T possibly damaging Het
Syne1 A G 10: 5,358,390 S722P possibly damaging Het
Szt2 A T 4: 118,398,201 S229T possibly damaging Het
Tm9sf3 A G 19: 41,218,191 L505P probably damaging Het
Ttc39d G A 17: 80,216,925 A338T probably damaging Het
Ubash3b A G 9: 41,023,518 F489L probably damaging Het
Xpo7 A T 14: 70,667,149 Y1015N probably benign Het
Zbtb14 C A 17: 69,388,307 Y333* probably null Het
Zp2 T C 7: 120,141,879 T141A probably benign Het
Other mutations in Sugp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Sugp2 APN 8 70242535 missense probably damaging 1.00
IGL01126:Sugp2 APN 8 70251874 missense probably damaging 1.00
IGL01154:Sugp2 APN 8 70242699 missense probably damaging 1.00
IGL02037:Sugp2 APN 8 70259674 splice site probably benign
IGL02401:Sugp2 APN 8 70243171 missense possibly damaging 0.75
IGL02738:Sugp2 APN 8 70243799 missense probably damaging 1.00
IGL03060:Sugp2 APN 8 70243187 missense possibly damaging 0.89
PIT4791001:Sugp2 UTSW 8 70260545 nonsense probably null
R0538:Sugp2 UTSW 8 70258948 missense probably damaging 1.00
R1459:Sugp2 UTSW 8 70244064 splice site probably benign
R1687:Sugp2 UTSW 8 70242634 missense probably damaging 1.00
R1801:Sugp2 UTSW 8 70236710 missense possibly damaging 0.86
R1914:Sugp2 UTSW 8 70253660 missense probably damaging 0.98
R1915:Sugp2 UTSW 8 70253660 missense probably damaging 0.98
R2004:Sugp2 UTSW 8 70242656 unclassified probably null
R2012:Sugp2 UTSW 8 70243211 missense possibly damaging 0.78
R4584:Sugp2 UTSW 8 70251898 missense probably benign 0.13
R4791:Sugp2 UTSW 8 70242790 missense probably damaging 1.00
R4970:Sugp2 UTSW 8 70259812 missense possibly damaging 0.94
R5101:Sugp2 UTSW 8 70260489 missense probably damaging 1.00
R5240:Sugp2 UTSW 8 70243275 missense probably benign 0.00
R5279:Sugp2 UTSW 8 70257107 intron probably benign
R5303:Sugp2 UTSW 8 70242177 intron probably benign
R5966:Sugp2 UTSW 8 70252103 critical splice donor site probably null
R5988:Sugp2 UTSW 8 70243225 missense probably benign
R6615:Sugp2 UTSW 8 70242770 missense possibly damaging 0.92
R7382:Sugp2 UTSW 8 70242844 missense probably benign 0.02
R7803:Sugp2 UTSW 8 70252072 missense probably benign
R7908:Sugp2 UTSW 8 70251927 missense probably benign 0.08
R7989:Sugp2 UTSW 8 70251927 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGGAACTGTGCCCATCCATC -3'
(R):5'- TGAGAGCAGAGAACCCTGTG -3'

Sequencing Primer
(F):5'- TTCACTGGAGGGCACTGAG -3'
(R):5'- AGAGAACCCTGTGCACTGTG -3'
Posted On2019-06-07