Incidental Mutation 'PIT4687001:Sbsn'
ID556187
Institutional Source Beutler Lab
Gene Symbol Sbsn
Ensembl Gene ENSMUSG00000046056
Gene Namesuprabasin
Synonyms1110005D19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #PIT4687001 (G1)
Quality Score173.492
Status Not validated
Chromosome7
Chromosomal Location30751471-30756134 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA to GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA at 30752966 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080518] [ENSMUST00000182227] [ENSMUST00000182229] [ENSMUST00000182721]
Predicted Effect probably benign
Transcript: ENSMUST00000080518
SMART Domains Protein: ENSMUSP00000079362
Gene: ENSMUSG00000046056

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
internal_repeat_2 27 208 2.58e-16 PROSPERO
internal_repeat_1 39 233 7e-25 PROSPERO
low complexity region 295 307 N/A INTRINSIC
low complexity region 313 325 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 349 361 N/A INTRINSIC
internal_repeat_2 380 568 2.58e-16 PROSPERO
internal_repeat_1 446 626 7e-25 PROSPERO
low complexity region 637 651 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182227
SMART Domains Protein: ENSMUSP00000138427
Gene: ENSMUSG00000046056

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 47 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182229
SMART Domains Protein: ENSMUSP00000138561
Gene: ENSMUSG00000046056

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 114 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182721
SMART Domains Protein: ENSMUSP00000138654
Gene: ENSMUSG00000046056

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
internal_repeat_1 26 68 1.41e-7 PROSPERO
internal_repeat_1 84 126 1.41e-7 PROSPERO
low complexity region 128 145 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T G 3: 138,289,835 V333G probably damaging Het
Aggf1 A G 13: 95,364,875 L333P probably damaging Het
Ankmy1 A G 1: 92,885,081 V502A probably benign Het
Atm A G 9: 53,486,812 probably null Het
Ccdc180 A G 4: 45,949,526 T1594A probably damaging Het
Cep290 T A 10: 100,537,591 D1244E probably benign Het
Ctnna3 A G 10: 64,834,606 D638G probably damaging Het
Ctsr T C 13: 61,160,532 H266R possibly damaging Het
D630045J12Rik C T 6: 38,195,101 E711K probably benign Het
Dnah5 T C 15: 28,383,577 S2982P probably damaging Het
Dsg1a G T 18: 20,331,698 A417S probably benign Het
Gdpd1 T C 11: 87,059,540 D69G probably damaging Het
Gm13103 C T 4: 143,846,533 probably benign Het
Gp2 C T 7: 119,451,578 R310H possibly damaging Het
Ifna2 G A 4: 88,683,305 H159Y possibly damaging Het
Kptn T C 7: 16,125,826 V325A probably damaging Het
March7 A G 2: 60,232,278 E143G probably damaging Het
Mcm4 A G 16: 15,636,713 L47P probably benign Het
Mcm8 T C 2: 132,817,177 F27S possibly damaging Het
Nod2 T A 8: 88,681,646 V967E probably damaging Het
Nrxn2 G A 19: 6,481,308 R659Q probably benign Het
Olfr120 T G 17: 37,726,191 C56G probably benign Het
Olfr1267-ps1 A G 2: 90,086,389 V24A probably benign Het
Parp10 C T 15: 76,240,922 R545Q probably benign Het
Ppp2r3a T C 9: 101,144,380 E332G probably benign Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Qsox2 G A 2: 26,222,288 L81F possibly damaging Het
Spata31 A G 13: 64,921,337 D433G probably benign Het
Stpg2 T C 3: 139,215,265 I77T possibly damaging Het
Sugp2 T C 8: 70,257,512 S928P probably damaging Het
Syne1 A G 10: 5,358,390 S722P possibly damaging Het
Szt2 A T 4: 118,398,201 S229T possibly damaging Het
Tm9sf3 A G 19: 41,218,191 L505P probably damaging Het
Ttc39d G A 17: 80,216,925 A338T probably damaging Het
Ubash3b A G 9: 41,023,518 F489L probably damaging Het
Xpo7 A T 14: 70,667,149 Y1015N probably benign Het
Zbtb14 C A 17: 69,388,307 Y333* probably null Het
Zp2 T C 7: 120,141,879 T141A probably benign Het
Other mutations in Sbsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01479:Sbsn APN 7 30752357 missense possibly damaging 0.90
IGL02649:Sbsn APN 7 30753258 missense probably damaging 0.96
IGL03154:Sbsn APN 7 30751728 missense possibly damaging 0.94
PIT4495001:Sbsn UTSW 7 30752966 intron probably benign
R0427:Sbsn UTSW 7 30752098 intron probably benign
R0892:Sbsn UTSW 7 30754819 missense possibly damaging 0.46
R1129:Sbsn UTSW 7 30753440 missense probably benign
R1388:Sbsn UTSW 7 30752151 missense probably benign 0.09
R1437:Sbsn UTSW 7 30753053 nonsense probably null
R2436:Sbsn UTSW 7 30752230 missense possibly damaging 0.53
R4020:Sbsn UTSW 7 30755965 missense probably damaging 0.98
R5485:Sbsn UTSW 7 30753117 missense possibly damaging 0.46
R5890:Sbsn UTSW 7 30753267 missense possibly damaging 0.46
R6616:Sbsn UTSW 7 30753279 missense possibly damaging 0.92
R6969:Sbsn UTSW 7 30753191 missense probably benign
R7302:Sbsn UTSW 7 30751884 missense probably benign 0.34
R7455:Sbsn UTSW 7 30753177 missense possibly damaging 0.46
R8225:Sbsn UTSW 7 30751994 intron probably benign
R8225:Sbsn UTSW 7 30752444 missense probably benign 0.00
R8330:Sbsn UTSW 7 30751941 missense possibly damaging 0.83
R8403:Sbsn UTSW 7 30751994 intron probably benign
Z1088:Sbsn UTSW 7 30751751 nonsense probably null
Z1177:Sbsn UTSW 7 30752330 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TAGCCATGCTGCAAAGGAGG -3'
(R):5'- AACCCAGTTTGGACCCCTTG -3'

Sequencing Primer
(F):5'- AGGCACAGCAGTTTGGTC -3'
(R):5'- TGGTTGACCCCAGTTTGGACAC -3'
Posted On2019-06-07