Incidental Mutation 'PIT4812001:Olfr15'
List |< first << previous [record 40 of 62] next >> last >|
ID556939
Institutional Source Beutler Lab
Gene Symbol Olfr15
Ensembl Gene ENSMUSG00000059043
Gene Nameolfactory receptor 15
SynonymsOR3, GA_x54KRFPKG5P-348087-349025, MOR256-17
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #PIT4812001 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location3830878-3844747 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 3839530 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 186 (K186*)
Ref Sequence ENSEMBL: ENSMUSP00000149504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080917] [ENSMUST00000214238] [ENSMUST00000214590]
Predicted Effect probably null
Transcript: ENSMUST00000080917
AA Change: K186*
SMART Domains Protein: ENSMUSP00000079720
Gene: ENSMUSG00000059043
AA Change: K186*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 25 301 2.7e-8 PFAM
Pfam:7tm_4 31 307 1.3e-52 PFAM
Pfam:7tm_1 41 290 9.8e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214238
AA Change: K186*
Predicted Effect probably null
Transcript: ENSMUST00000214590
AA Change: K186*
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Olfr15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01973:Olfr15 APN 16 3839777 missense probably damaging 0.99
IGL02444:Olfr15 APN 16 3839687 missense probably damaging 1.00
IGL02516:Olfr15 APN 16 3839336 missense probably damaging 1.00
IGL02941:Olfr15 APN 16 3839816 missense possibly damaging 0.64
R0380:Olfr15 UTSW 16 3838985 missense probably benign
R1542:Olfr15 UTSW 16 3839832 missense probably damaging 1.00
R1574:Olfr15 UTSW 16 3839657 missense probably damaging 0.99
R1574:Olfr15 UTSW 16 3839657 missense probably damaging 0.99
R1633:Olfr15 UTSW 16 3839532 missense probably damaging 1.00
R4207:Olfr15 UTSW 16 3839570 missense probably damaging 1.00
R4632:Olfr15 UTSW 16 3839087 missense probably damaging 1.00
R4965:Olfr15 UTSW 16 3839570 missense probably damaging 1.00
R5014:Olfr15 UTSW 16 3839048 missense probably benign 0.01
R6575:Olfr15 UTSW 16 3839030 missense probably benign 0.00
R7367:Olfr15 UTSW 16 3839302 missense probably damaging 0.99
R7523:Olfr15 UTSW 16 3839699 missense probably benign
R7697:Olfr15 UTSW 16 3839566 missense probably damaging 0.96
R7876:Olfr15 UTSW 16 3838794 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGAGTGCATACTGCTCGTG -3'
(R):5'- GGAGACACACGTATTGAAAGCC -3'

Sequencing Primer
(F):5'- CATACTGCTCGTGGTGATGGC -3'
(R):5'- CACGTATTGAAAGCCTTTCGACG -3'
Posted On2019-06-07