Incidental Mutation 'R7195:Cep19'
ID559887
Institutional Source Beutler Lab
Gene Symbol Cep19
Ensembl Gene ENSMUSG00000035790
Gene Namecentrosomal protein 19
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7195 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location32099800-32108069 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32107086 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 104 (D104G)
Ref Sequence ENSEMBL: ENSMUSP00000110822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042869] [ENSMUST00000115168] [ENSMUST00000169186]
Predicted Effect probably damaging
Transcript: ENSMUST00000042869
AA Change: D104G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046587
Gene: ENSMUSG00000035790
AA Change: D104G

DomainStartEndE-ValueType
Pfam:CEP19 6 156 4.8e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115168
AA Change: D104G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110822
Gene: ENSMUSG00000035790
AA Change: D104G

DomainStartEndE-ValueType
Pfam:CEP19 6 156 4.8e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169186
AA Change: D104G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126083
Gene: ENSMUSG00000035790
AA Change: D104G

DomainStartEndE-ValueType
Pfam:CEP19 6 156 4.3e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to centrosomes and primary cilia and co-localizes with a marker for the mother centriole. This gene resides in a region of human chromosome 3 that is linked to morbid obesity. A homozygous knockout of the orthologous gene in mouse resulted in mice with morbid obesity, hyperphagy, glucose intolerance, and insulin resistance. Mutations in this gene cause morbid obesity and spermatogenic failure (MOSPGF). This gene has a pseudogene on human chromosome 2. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit obesity, hyperphagia, glucose intolerant and insulin resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T C 11: 58,288,416 probably null Het
4930563D23Rik C T 16: 92,321,149 V84M probably damaging Het
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Actl11 A T 9: 107,928,870 K131* probably null Het
Adam39 A T 8: 40,824,775 R68* probably null Het
Akap7 A T 10: 25,271,507 N108K probably damaging Het
Arhgef10l C A 4: 140,611,410 A14S probably benign Het
BC067074 A T 13: 113,367,929 D1864V Het
Ccdc141 T G 2: 77,049,583 N632T probably benign Het
Ccm2 T C 11: 6,596,302 S435P probably damaging Het
Cd36 A G 5: 17,814,189 L178P probably damaging Het
Cd7 T C 11: 121,038,249 I59V probably benign Het
Cds2 T A 2: 132,293,284 S32T probably benign Het
Col1a2 C T 6: 4,510,753 P68S unknown Het
Col20a1 A G 2: 181,007,231 H1011R probably damaging Het
D7Ertd443e A G 7: 134,295,122 V513A probably damaging Het
Egfr C T 11: 16,868,162 P228L probably damaging Het
Fam78b A G 1: 167,078,562 R97G probably damaging Het
Flt1 C T 5: 147,603,576 V768M probably damaging Het
Gdap1l1 A T 2: 163,446,130 N96Y probably damaging Het
Gm7168 T A 17: 13,949,360 Y330N probably benign Het
Hnrnpul1 T C 7: 25,724,778 N683S unknown Het
Ice2 C T 9: 69,428,500 P922S possibly damaging Het
Iglv2 A G 16: 19,260,510 V81A not run Het
Irs1 A G 1: 82,287,456 I1013T probably benign Het
Itih4 T C 14: 30,899,475 S832P probably damaging Het
Klhl1 A T 14: 96,280,077 Y388N probably benign Het
Lrrc37a G A 11: 103,457,775 S2698L unknown Het
Map4k4 T C 1: 40,019,669 Y1008H possibly damaging Het
Mdn1 G T 4: 32,701,823 G1519W probably damaging Het
Mga T A 2: 119,917,328 D653E probably damaging Het
Npas1 T C 7: 16,474,808 E48G probably damaging Het
Nup188 G A 2: 30,341,830 probably null Het
Olfr1215 G A 2: 89,001,731 L186F Het
Olfr33 A G 7: 102,713,666 V249A possibly damaging Het
Olfr399 T A 11: 74,054,397 M121L probably damaging Het
Olfr404-ps1 G T 11: 74,239,568 M1I probably null Het
Olfr544 A T 7: 102,484,367 V251D probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Oxct1 T C 15: 4,128,901 V439A probably damaging Het
Pcdhb22 G T 18: 37,519,288 G13W probably damaging Het
Pex11g A G 8: 3,459,237 V230A probably benign Het
Pop1 C T 15: 34,510,379 S439L probably damaging Het
Ptpn9 T A 9: 57,022,249 H83Q probably benign Het
Qrfp C T 2: 31,808,692 R76H probably benign Het
Slc30a3 A G 5: 31,088,795 V197A probably benign Het
Slc8a3 T C 12: 81,314,273 N591D possibly damaging Het
Sp4 G T 12: 118,300,072 Q80K possibly damaging Het
Spock1 C T 13: 57,907,502 G29D possibly damaging Het
Sprr1a G T 3: 92,484,367 P109Q probably damaging Het
Suz12 T A 11: 80,013,483 F239L probably damaging Het
Tbx3 A G 5: 119,675,583 Y248C probably damaging Het
Trabd2b T C 4: 114,409,440 L217P probably damaging Het
Ubxn11 A C 4: 134,126,415 I398L possibly damaging Het
Vmn1r173 T A 7: 23,702,459 S40T probably damaging Het
Vmn2r2 T C 3: 64,116,479 S894G probably benign Het
Vmn2r65 A G 7: 84,943,139 probably null Het
Vps13c G A 9: 67,945,825 G2400D possibly damaging Het
Vps8 T C 16: 21,456,282 Y197H probably damaging Het
Wdr91 T C 6: 34,889,274 N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 I695T possibly damaging Het
Zc3hc1 T C 6: 30,382,548 D133G probably benign Het
Zcchc14 T C 8: 121,608,461 I307V unknown Het
Zfp933 G A 4: 147,826,179 T320I probably benign Het
Other mutations in Cep19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Cep19 APN 16 32107080 missense probably damaging 0.98
R0616:Cep19 UTSW 16 32104011 missense probably damaging 1.00
R1526:Cep19 UTSW 16 32107221 missense possibly damaging 0.88
R4344:Cep19 UTSW 16 32107065 missense probably damaging 0.99
R5590:Cep19 UTSW 16 32103898 unclassified probably benign
R6798:Cep19 UTSW 16 32104049 critical splice donor site probably null
R6925:Cep19 UTSW 16 32103942 missense probably damaging 1.00
R7223:Cep19 UTSW 16 32104015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGATTGCACCAGAGCTGC -3'
(R):5'- GATCTTTGTTCTCTGAGGAAACGTG -3'

Sequencing Primer
(F):5'- TGCGGAACAGTTAAAGAATAACCC -3'
(R):5'- AAACGTGGAGCGCTTCCTC -3'
Posted On2019-06-26