Incidental Mutation 'R7195:Olfr1215'
ID559833
Institutional Source Beutler Lab
Gene Symbol Olfr1215
Ensembl Gene ENSMUSG00000100016
Gene Nameolfactory receptor 1215
SynonymsGA_x6K02T2Q125-50482823-50481885, MOR233-13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7195 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89000021-89006973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 89001731 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 186 (L186F)
Ref Sequence ENSEMBL: ENSMUSP00000150030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000188399] [ENSMUST00000214809] [ENSMUST00000216271]
Predicted Effect
SMART Domains Protein: ENSMUSP00000141134
Gene: ENSMUSG00000100016
AA Change: L186F

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
Pfam:7tm_1 39 286 1.9e-25 PFAM
Pfam:7tm_4 138 283 1.7e-38 PFAM
Predicted Effect
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T C 11: 58,288,416 probably null Het
4930563D23Rik C T 16: 92,321,149 V84M probably damaging Het
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Actl11 A T 9: 107,928,870 K131* probably null Het
Adam39 A T 8: 40,824,775 R68* probably null Het
Akap7 A T 10: 25,271,507 N108K probably damaging Het
Arhgef10l C A 4: 140,611,410 A14S probably benign Het
BC067074 A T 13: 113,367,929 D1864V Het
Ccdc141 T G 2: 77,049,583 N632T probably benign Het
Ccm2 T C 11: 6,596,302 S435P probably damaging Het
Cd36 A G 5: 17,814,189 L178P probably damaging Het
Cd7 T C 11: 121,038,249 I59V probably benign Het
Cds2 T A 2: 132,293,284 S32T probably benign Het
Cep19 A G 16: 32,107,086 D104G probably damaging Het
Col1a2 C T 6: 4,510,753 P68S unknown Het
Col20a1 A G 2: 181,007,231 H1011R probably damaging Het
D7Ertd443e A G 7: 134,295,122 V513A probably damaging Het
Egfr C T 11: 16,868,162 P228L probably damaging Het
Fam78b A G 1: 167,078,562 R97G probably damaging Het
Flt1 C T 5: 147,603,576 V768M probably damaging Het
Gdap1l1 A T 2: 163,446,130 N96Y probably damaging Het
Gm7168 T A 17: 13,949,360 Y330N probably benign Het
Hnrnpul1 T C 7: 25,724,778 N683S unknown Het
Ice2 C T 9: 69,428,500 P922S possibly damaging Het
Iglv2 A G 16: 19,260,510 V81A not run Het
Irs1 A G 1: 82,287,456 I1013T probably benign Het
Itih4 T C 14: 30,899,475 S832P probably damaging Het
Klhl1 A T 14: 96,280,077 Y388N probably benign Het
Lrrc37a G A 11: 103,457,775 S2698L unknown Het
Map4k4 T C 1: 40,019,669 Y1008H possibly damaging Het
Mdn1 G T 4: 32,701,823 G1519W probably damaging Het
Mga T A 2: 119,917,328 D653E probably damaging Het
Npas1 T C 7: 16,474,808 E48G probably damaging Het
Nup188 G A 2: 30,341,830 probably null Het
Olfr33 A G 7: 102,713,666 V249A possibly damaging Het
Olfr399 T A 11: 74,054,397 M121L probably damaging Het
Olfr404-ps1 G T 11: 74,239,568 M1I probably null Het
Olfr544 A T 7: 102,484,367 V251D probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Oxct1 T C 15: 4,128,901 V439A probably damaging Het
Pcdhb22 G T 18: 37,519,288 G13W probably damaging Het
Pex11g A G 8: 3,459,237 V230A probably benign Het
Pop1 C T 15: 34,510,379 S439L probably damaging Het
Ptpn9 T A 9: 57,022,249 H83Q probably benign Het
Qrfp C T 2: 31,808,692 R76H probably benign Het
Slc30a3 A G 5: 31,088,795 V197A probably benign Het
Slc8a3 T C 12: 81,314,273 N591D possibly damaging Het
Sp4 G T 12: 118,300,072 Q80K possibly damaging Het
Spock1 C T 13: 57,907,502 G29D possibly damaging Het
Sprr1a G T 3: 92,484,367 P109Q probably damaging Het
Suz12 T A 11: 80,013,483 F239L probably damaging Het
Tbx3 A G 5: 119,675,583 Y248C probably damaging Het
Trabd2b T C 4: 114,409,440 L217P probably damaging Het
Ubxn11 A C 4: 134,126,415 I398L possibly damaging Het
Vmn1r173 T A 7: 23,702,459 S40T probably damaging Het
Vmn2r2 T C 3: 64,116,479 S894G probably benign Het
Vmn2r65 A G 7: 84,943,139 probably null Het
Vps13c G A 9: 67,945,825 G2400D possibly damaging Het
Vps8 T C 16: 21,456,282 Y197H probably damaging Het
Wdr91 T C 6: 34,889,274 N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 I695T possibly damaging Het
Zc3hc1 T C 6: 30,382,548 D133G probably benign Het
Zcchc14 T C 8: 121,608,461 I307V unknown Het
Zfp933 G A 4: 147,826,179 T320I probably benign Het
Other mutations in Olfr1215
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Olfr1215 APN 2 89001339 utr 3 prime probably benign
IGL02395:Olfr1215 APN 2 89002163 missense probably benign 0.00
IGL02399:Olfr1215 APN 2 89002163 missense probably benign 0.00
IGL02409:Olfr1215 APN 2 89001910 missense possibly damaging 0.75
IGL02421:Olfr1215 APN 2 89001344 unclassified probably null
IGL03036:Olfr1215 APN 2 89002115 missense possibly damaging 0.94
R2036:Olfr1215 UTSW 2 89001632 missense probably damaging 0.97
R2199:Olfr1215 UTSW 2 89001550 missense probably damaging 0.98
R3930:Olfr1215 UTSW 2 89002033 missense probably benign 0.32
R4990:Olfr1215 UTSW 2 89001472 missense probably damaging 0.97
R5199:Olfr1215 UTSW 2 89001763 missense possibly damaging 0.70
R5368:Olfr1215 UTSW 2 89002091 missense probably damaging 1.00
R5396:Olfr1215 UTSW 2 89002196 missense probably benign 0.15
R6881:Olfr1215 UTSW 2 89001937 missense probably damaging 1.00
R7425:Olfr1215 UTSW 2 89002200 missense
R7804:Olfr1215 UTSW 2 89001511 missense unknown
R8094:Olfr1215 UTSW 2 89002368 start gained probably benign
Z1088:Olfr1215 UTSW 2 89001838 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CACAACAGTAATGTGGGACCC -3'
(R):5'- GTGATCATTCTGGCAGCTATGG -3'

Sequencing Primer
(F):5'- CACAGGTAGAGAGAGCTTTACGTCTC -3'
(R):5'- ACCGGTATGTAGCCATTTGTAAGC -3'
Posted On2019-06-26