Incidental Mutation 'R7195:4930438A08Rik'
ID559871
Institutional Source Beutler Lab
Gene Symbol 4930438A08Rik
Ensembl Gene ENSMUSG00000069873
Gene NameRIKEN cDNA 4930438A08 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7195 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location58274799-58294289 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 58288416 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108834] [ENSMUST00000108834] [ENSMUST00000208022] [ENSMUST00000208022]
Predicted Effect probably null
Transcript: ENSMUST00000108834
SMART Domains Protein: ENSMUSP00000104462
Gene: ENSMUSG00000069873

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pyr_redox_2 29 166 2e-8 PFAM
Pfam:AlaDh_PNT_C 48 124 8.8e-8 PFAM
Pfam:FAD_binding_3 61 98 1.9e-7 PFAM
Pfam:HI0933_like 62 103 3.1e-8 PFAM
Pfam:Pyr_redox 63 105 1.8e-7 PFAM
Pfam:FAD_binding_2 63 119 8.7e-9 PFAM
Pfam:DAO 63 212 2.9e-8 PFAM
Pfam:NAD_binding_8 66 133 7.1e-15 PFAM
Pfam:Amino_oxidase 71 270 7e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108834
SMART Domains Protein: ENSMUSP00000104462
Gene: ENSMUSG00000069873

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pyr_redox_2 29 166 2e-8 PFAM
Pfam:AlaDh_PNT_C 48 124 8.8e-8 PFAM
Pfam:FAD_binding_3 61 98 1.9e-7 PFAM
Pfam:HI0933_like 62 103 3.1e-8 PFAM
Pfam:Pyr_redox 63 105 1.8e-7 PFAM
Pfam:FAD_binding_2 63 119 8.7e-9 PFAM
Pfam:DAO 63 212 2.9e-8 PFAM
Pfam:NAD_binding_8 66 133 7.1e-15 PFAM
Pfam:Amino_oxidase 71 270 7e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000208022
Predicted Effect probably null
Transcript: ENSMUST00000208022
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik C T 16: 92,321,149 V84M probably damaging Het
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Actl11 A T 9: 107,928,870 K131* probably null Het
Adam39 A T 8: 40,824,775 R68* probably null Het
Akap7 A T 10: 25,271,507 N108K probably damaging Het
Arhgef10l C A 4: 140,611,410 A14S probably benign Het
BC067074 A T 13: 113,367,929 D1864V Het
Ccdc141 T G 2: 77,049,583 N632T probably benign Het
Ccm2 T C 11: 6,596,302 S435P probably damaging Het
Cd36 A G 5: 17,814,189 L178P probably damaging Het
Cd7 T C 11: 121,038,249 I59V probably benign Het
Cds2 T A 2: 132,293,284 S32T probably benign Het
Cep19 A G 16: 32,107,086 D104G probably damaging Het
Col1a2 C T 6: 4,510,753 P68S unknown Het
Col20a1 A G 2: 181,007,231 H1011R probably damaging Het
D7Ertd443e A G 7: 134,295,122 V513A probably damaging Het
Egfr C T 11: 16,868,162 P228L probably damaging Het
Fam78b A G 1: 167,078,562 R97G probably damaging Het
Flt1 C T 5: 147,603,576 V768M probably damaging Het
Gdap1l1 A T 2: 163,446,130 N96Y probably damaging Het
Gm7168 T A 17: 13,949,360 Y330N probably benign Het
Hnrnpul1 T C 7: 25,724,778 N683S unknown Het
Ice2 C T 9: 69,428,500 P922S possibly damaging Het
Iglv2 A G 16: 19,260,510 V81A not run Het
Irs1 A G 1: 82,287,456 I1013T probably benign Het
Itih4 T C 14: 30,899,475 S832P probably damaging Het
Klhl1 A T 14: 96,280,077 Y388N probably benign Het
Lrrc37a G A 11: 103,457,775 S2698L unknown Het
Map4k4 T C 1: 40,019,669 Y1008H possibly damaging Het
Mdn1 G T 4: 32,701,823 G1519W probably damaging Het
Mga T A 2: 119,917,328 D653E probably damaging Het
Npas1 T C 7: 16,474,808 E48G probably damaging Het
Nup188 G A 2: 30,341,830 probably null Het
Olfr1215 G A 2: 89,001,731 L186F Het
Olfr33 A G 7: 102,713,666 V249A possibly damaging Het
Olfr399 T A 11: 74,054,397 M121L probably damaging Het
Olfr404-ps1 G T 11: 74,239,568 M1I probably null Het
Olfr544 A T 7: 102,484,367 V251D probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Oxct1 T C 15: 4,128,901 V439A probably damaging Het
Pcdhb22 G T 18: 37,519,288 G13W probably damaging Het
Pex11g A G 8: 3,459,237 V230A probably benign Het
Pop1 C T 15: 34,510,379 S439L probably damaging Het
Ptpn9 T A 9: 57,022,249 H83Q probably benign Het
Qrfp C T 2: 31,808,692 R76H probably benign Het
Slc30a3 A G 5: 31,088,795 V197A probably benign Het
Slc8a3 T C 12: 81,314,273 N591D possibly damaging Het
Sp4 G T 12: 118,300,072 Q80K possibly damaging Het
Spock1 C T 13: 57,907,502 G29D possibly damaging Het
Sprr1a G T 3: 92,484,367 P109Q probably damaging Het
Suz12 T A 11: 80,013,483 F239L probably damaging Het
Tbx3 A G 5: 119,675,583 Y248C probably damaging Het
Trabd2b T C 4: 114,409,440 L217P probably damaging Het
Ubxn11 A C 4: 134,126,415 I398L possibly damaging Het
Vmn1r173 T A 7: 23,702,459 S40T probably damaging Het
Vmn2r2 T C 3: 64,116,479 S894G probably benign Het
Vmn2r65 A G 7: 84,943,139 probably null Het
Vps13c G A 9: 67,945,825 G2400D possibly damaging Het
Vps8 T C 16: 21,456,282 Y197H probably damaging Het
Wdr91 T C 6: 34,889,274 N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 I695T possibly damaging Het
Zc3hc1 T C 6: 30,382,548 D133G probably benign Het
Zcchc14 T C 8: 121,608,461 I307V unknown Het
Zfp933 G A 4: 147,826,179 T320I probably benign Het
Other mutations in 4930438A08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02884:4930438A08Rik APN 11 58287476 missense probably benign 0.01
IGL03088:4930438A08Rik APN 11 58293384 missense unknown
R0715:4930438A08Rik UTSW 11 58288350 missense probably damaging 1.00
R1139:4930438A08Rik UTSW 11 58288286 missense probably damaging 1.00
R1833:4930438A08Rik UTSW 11 58288388 nonsense probably null
R5906:4930438A08Rik UTSW 11 58291434 splice site probably null
R6056:4930438A08Rik UTSW 11 58293638 missense probably damaging 0.96
R6288:4930438A08Rik UTSW 11 58293595 missense probably damaging 1.00
R6981:4930438A08Rik UTSW 11 58293718 unclassified probably benign
R6989:4930438A08Rik UTSW 11 58287402 missense possibly damaging 0.88
R7344:4930438A08Rik UTSW 11 58291447 missense
R7651:4930438A08Rik UTSW 11 58293362 missense
R8141:4930438A08Rik UTSW 11 58286585 missense
R8187:4930438A08Rik UTSW 11 58289722 missense
R8214:4930438A08Rik UTSW 11 58286621 missense
R8228:4930438A08Rik UTSW 11 58291555 missense
Predicted Primers PCR Primer
(F):5'- ACAGGCTTTCTCATGAACTCATC -3'
(R):5'- TACACTCCCTGAAGAGCCAG -3'

Sequencing Primer
(F):5'- TGCTGGTCAATGGAGTTC -3'
(R):5'- CAGTGGCTGACATGGGAC -3'
Posted On2019-06-26