Incidental Mutation 'R7195:Ubxn11'
ID559843
Institutional Source Beutler Lab
Gene Symbol Ubxn11
Ensembl Gene ENSMUSG00000012126
Gene NameUBX domain protein 11
SynonymsSoci, 4930506L07Rik, Ubxd5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R7195 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location134102570-134127593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 134126415 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 398 (I398L)
Ref Sequence ENSEMBL: ENSMUSP00000074255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030651] [ENSMUST00000040271] [ENSMUST00000070246] [ENSMUST00000074690] [ENSMUST00000105879] [ENSMUST00000121566] [ENSMUST00000151113]
Predicted Effect probably benign
Transcript: ENSMUST00000030651
SMART Domains Protein: ENSMUSP00000030651
Gene: ENSMUSG00000028843

DomainStartEndE-ValueType
Pfam:SH3BGR 2 93 6.3e-40 PFAM
Pfam:Glutaredoxin 22 70 9.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040271
SMART Domains Protein: ENSMUSP00000039889
Gene: ENSMUSG00000037443

DomainStartEndE-ValueType
coiled coil region 333 656 N/A INTRINSIC
coiled coil region 725 749 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000070246
AA Change: I280L

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064030
Gene: ENSMUSG00000012126
AA Change: I280L

DomainStartEndE-ValueType
Pfam:SEP 114 185 1.5e-20 PFAM
UBX 268 350 2.3e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000074690
AA Change: I398L

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074255
Gene: ENSMUSG00000012126
AA Change: I398L

DomainStartEndE-ValueType
coiled coil region 69 147 N/A INTRINSIC
Pfam:SEP 232 303 7.9e-20 PFAM
UBX 386 468 2.3e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105879
Predicted Effect probably benign
Transcript: ENSMUST00000121566
SMART Domains Protein: ENSMUSP00000113351
Gene: ENSMUSG00000037443

DomainStartEndE-ValueType
coiled coil region 331 654 N/A INTRINSIC
coiled coil region 723 747 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000151113
AA Change: I147L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122892
Gene: ENSMUSG00000012126
AA Change: I147L

DomainStartEndE-ValueType
Blast:SEP 15 64 2e-13 BLAST
SCOP:d1i42a_ 129 173 4e-5 SMART
Blast:UBX 135 174 1e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a divergent C-terminal UBX domain. The homologous protein in the rat interacts with members of the Rnd subfamily of Rho GTPases at the cell periphery through its C-terminal region. It also interacts with several heterotrimeric G proteins through their G-alpha subunits and promotes Rho GTPase activation. It is proposed to serve a bidirectional role in the promotion and inhibition of Rho activity through upstream signaling pathways. The 3' coding sequence of this gene contains a polymoprhic region of 24 nt tandem repeats. Several transcripts containing between 1.5 and five repeat units have been reported. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T C 11: 58,288,416 probably null Het
4930563D23Rik C T 16: 92,321,149 V84M probably damaging Het
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Actl11 A T 9: 107,928,870 K131* probably null Het
Adam39 A T 8: 40,824,775 R68* probably null Het
Akap7 A T 10: 25,271,507 N108K probably damaging Het
Arhgef10l C A 4: 140,611,410 A14S probably benign Het
BC067074 A T 13: 113,367,929 D1864V Het
Ccdc141 T G 2: 77,049,583 N632T probably benign Het
Ccm2 T C 11: 6,596,302 S435P probably damaging Het
Cd36 A G 5: 17,814,189 L178P probably damaging Het
Cd7 T C 11: 121,038,249 I59V probably benign Het
Cds2 T A 2: 132,293,284 S32T probably benign Het
Cep19 A G 16: 32,107,086 D104G probably damaging Het
Col1a2 C T 6: 4,510,753 P68S unknown Het
Col20a1 A G 2: 181,007,231 H1011R probably damaging Het
D7Ertd443e A G 7: 134,295,122 V513A probably damaging Het
Egfr C T 11: 16,868,162 P228L probably damaging Het
Fam78b A G 1: 167,078,562 R97G probably damaging Het
Flt1 C T 5: 147,603,576 V768M probably damaging Het
Gdap1l1 A T 2: 163,446,130 N96Y probably damaging Het
Gm7168 T A 17: 13,949,360 Y330N probably benign Het
Hnrnpul1 T C 7: 25,724,778 N683S unknown Het
Ice2 C T 9: 69,428,500 P922S possibly damaging Het
Iglv2 A G 16: 19,260,510 V81A not run Het
Irs1 A G 1: 82,287,456 I1013T probably benign Het
Itih4 T C 14: 30,899,475 S832P probably damaging Het
Klhl1 A T 14: 96,280,077 Y388N probably benign Het
Lrrc37a G A 11: 103,457,775 S2698L unknown Het
Map4k4 T C 1: 40,019,669 Y1008H possibly damaging Het
Mdn1 G T 4: 32,701,823 G1519W probably damaging Het
Mga T A 2: 119,917,328 D653E probably damaging Het
Npas1 T C 7: 16,474,808 E48G probably damaging Het
Nup188 G A 2: 30,341,830 probably null Het
Olfr1215 G A 2: 89,001,731 L186F Het
Olfr33 A G 7: 102,713,666 V249A possibly damaging Het
Olfr399 T A 11: 74,054,397 M121L probably damaging Het
Olfr404-ps1 G T 11: 74,239,568 M1I probably null Het
Olfr544 A T 7: 102,484,367 V251D probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Oxct1 T C 15: 4,128,901 V439A probably damaging Het
Pcdhb22 G T 18: 37,519,288 G13W probably damaging Het
Pex11g A G 8: 3,459,237 V230A probably benign Het
Pop1 C T 15: 34,510,379 S439L probably damaging Het
Ptpn9 T A 9: 57,022,249 H83Q probably benign Het
Qrfp C T 2: 31,808,692 R76H probably benign Het
Slc30a3 A G 5: 31,088,795 V197A probably benign Het
Slc8a3 T C 12: 81,314,273 N591D possibly damaging Het
Sp4 G T 12: 118,300,072 Q80K possibly damaging Het
Spock1 C T 13: 57,907,502 G29D possibly damaging Het
Sprr1a G T 3: 92,484,367 P109Q probably damaging Het
Suz12 T A 11: 80,013,483 F239L probably damaging Het
Tbx3 A G 5: 119,675,583 Y248C probably damaging Het
Trabd2b T C 4: 114,409,440 L217P probably damaging Het
Vmn1r173 T A 7: 23,702,459 S40T probably damaging Het
Vmn2r2 T C 3: 64,116,479 S894G probably benign Het
Vmn2r65 A G 7: 84,943,139 probably null Het
Vps13c G A 9: 67,945,825 G2400D possibly damaging Het
Vps8 T C 16: 21,456,282 Y197H probably damaging Het
Wdr91 T C 6: 34,889,274 N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 I695T possibly damaging Het
Zc3hc1 T C 6: 30,382,548 D133G probably benign Het
Zcchc14 T C 8: 121,608,461 I307V unknown Het
Zfp933 G A 4: 147,826,179 T320I probably benign Het
Other mutations in Ubxn11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02547:Ubxn11 APN 4 134109584 missense possibly damaging 0.82
IGL02559:Ubxn11 APN 4 134124943 missense probably damaging 0.98
R0015:Ubxn11 UTSW 4 134116025 splice site probably null
R0586:Ubxn11 UTSW 4 134109652 missense possibly damaging 0.49
R1449:Ubxn11 UTSW 4 134124892 missense probably damaging 1.00
R1513:Ubxn11 UTSW 4 134124141 critical splice donor site probably null
R1860:Ubxn11 UTSW 4 134124838 missense probably damaging 1.00
R3776:Ubxn11 UTSW 4 134108294 missense probably damaging 1.00
R4395:Ubxn11 UTSW 4 134116120 missense possibly damaging 0.53
R4840:Ubxn11 UTSW 4 134109608 missense probably damaging 1.00
R5387:Ubxn11 UTSW 4 134123426 missense probably damaging 1.00
R5460:Ubxn11 UTSW 4 134125085 missense probably damaging 1.00
R5560:Ubxn11 UTSW 4 134126624 missense probably damaging 1.00
R6611:Ubxn11 UTSW 4 134123599 missense probably damaging 1.00
R6901:Ubxn11 UTSW 4 134126264 missense probably damaging 0.99
R7448:Ubxn11 UTSW 4 134125155 missense probably damaging 1.00
R7453:Ubxn11 UTSW 4 134126229 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTCCAGAACTGCTGCCCAATG -3'
(R):5'- GCTGAATCCATGTCCCTGGATG -3'

Sequencing Primer
(F):5'- AATGCCTGCCCGGATCCAG -3'
(R):5'- TGGATGGCCAGCAGAGTACATC -3'
Posted On2019-06-26