Incidental Mutation 'R7257:Pip5kl1'
ID564313
Institutional Source Beutler Lab
Gene Symbol Pip5kl1
Ensembl Gene ENSMUSG00000046854
Gene Namephosphatidylinositol-4-phosphate 5-kinase-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R7257 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32574797-32583782 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 32580431 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055304] [ENSMUST00000055304] [ENSMUST00000055304] [ENSMUST00000055304] [ENSMUST00000055304] [ENSMUST00000055304] [ENSMUST00000100188] [ENSMUST00000100190]
Predicted Effect probably null
Transcript: ENSMUST00000055304
SMART Domains Protein: ENSMUSP00000051282
Gene: ENSMUSG00000046854

DomainStartEndE-ValueType
Pfam:PIP5K 127 393 4.2e-62 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000055304
SMART Domains Protein: ENSMUSP00000051282
Gene: ENSMUSG00000046854

DomainStartEndE-ValueType
Pfam:PIP5K 127 393 4.2e-62 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000055304
SMART Domains Protein: ENSMUSP00000051282
Gene: ENSMUSG00000046854

DomainStartEndE-ValueType
Pfam:PIP5K 127 393 4.2e-62 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000055304
SMART Domains Protein: ENSMUSP00000051282
Gene: ENSMUSG00000046854

DomainStartEndE-ValueType
Pfam:PIP5K 127 393 4.2e-62 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000055304
SMART Domains Protein: ENSMUSP00000051282
Gene: ENSMUSG00000046854

DomainStartEndE-ValueType
Pfam:PIP5K 127 393 4.2e-62 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000055304
SMART Domains Protein: ENSMUSP00000051282
Gene: ENSMUSG00000046854

DomainStartEndE-ValueType
Pfam:PIP5K 127 393 4.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100188
SMART Domains Protein: ENSMUSP00000097763
Gene: ENSMUSG00000046854

DomainStartEndE-ValueType
Pfam:PIP5K 165 358 4.3e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100190
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PIP5KL1 is a phosphoinositide kinase-like protein that lacks intrinsic lipid kinase activity but associates with type I PIPKs (see PIP5K1A; MIM 603275) and may play a role in localization of PIPK activity (Chang et al., 2004 [PubMed 14701839]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A T 6: 88,839,452 V120E probably benign Het
Acot11 G A 4: 106,758,402 T284M probably damaging Het
Adk G T 14: 21,052,671 K11N probably damaging Het
Akr1c14 T A 13: 4,088,966 N316K probably benign Het
AL732309.1 A T 2: 25,245,839 V121D probably benign Het
Amh C A 10: 80,806,653 Q257K probably benign Het
Antxrl T G 14: 34,065,849 H276Q probably benign Het
Atp5o G A 16: 91,926,867 T105M probably damaging Het
Atp5s T C 12: 69,741,669 I114T probably damaging Het
Atxn2 T G 5: 121,785,817 N734K possibly damaging Het
B3gat3 T A 19: 8,925,738 V153D probably benign Het
Brd2 A G 17: 34,113,822 V528A probably damaging Het
Camk2g T C 14: 20,747,839 S335G probably benign Het
Cbln2 T A 18: 86,716,734 W211R probably damaging Het
Cry2 A T 2: 92,412,981 I505N possibly damaging Het
Ddx55 T A 5: 124,560,721 C249S possibly damaging Het
Dglucy A G 12: 100,842,738 T232A probably damaging Het
Dhx32 A G 7: 133,759,477 Y76H probably benign Het
Dock7 T A 4: 98,973,412 N1356I unknown Het
Dock8 T A 19: 25,127,085 N710K probably benign Het
Dync1i2 T A 2: 71,249,356 N391K possibly damaging Het
Ect2 A G 3: 27,138,535 S420P probably damaging Het
Efcab5 T A 11: 77,137,779 E242V probably damaging Het
Fam83g T A 11: 61,684,753 Y74N probably damaging Het
Fbxo34 T A 14: 47,500,872 probably null Het
Flt4 A G 11: 49,626,009 T208A probably benign Het
Fxyd5 T A 7: 31,035,151 H183L unknown Het
Gpr150 T G 13: 76,056,466 D120A probably benign Het
Grm7 A G 6: 110,646,118 Y84C probably damaging Het
Ighmbp2 A G 19: 3,266,405 S562P probably damaging Het
Itga7 A G 10: 128,944,413 Y530C possibly damaging Het
Itpr3 T A 17: 27,118,561 D2448E probably benign Het
Mmp17 C A 5: 129,595,633 H216Q probably benign Het
Mns1 C T 9: 72,452,815 R416W probably damaging Het
Mog A G 17: 37,023,127 S25P unknown Het
Myh2 A G 11: 67,181,150 K568R possibly damaging Het
Myh7 A T 14: 54,972,490 probably null Het
Mymk A T 2: 27,067,368 W79R probably damaging Het
Ncoa4 T G 14: 32,177,369 L623R probably damaging Het
Oca2 G A 7: 56,279,538 probably benign Het
Odam A C 5: 87,887,545 S123R probably benign Het
Olfr1155 A G 2: 87,943,571 F19S probably damaging Het
Olfr263 A G 13: 21,133,257 T161A probably benign Het
Olfr292 T A 7: 86,694,804 M116K probably damaging Het
Olfr583 T C 7: 103,051,630 F111L probably benign Het
Olfr765 C T 10: 129,046,455 V203M probably benign Het
Olfr816 T A 10: 129,912,287 probably benign Het
Ovch2 C T 7: 107,794,433 C162Y probably damaging Het
Padi1 C A 4: 140,829,471 G142C probably damaging Het
Pcdhga4 A G 18: 37,687,398 I667V probably damaging Het
Pfas A T 11: 68,992,959 V624E probably damaging Het
Phb A T 11: 95,678,091 E184V probably damaging Het
Phlpp2 G T 8: 109,940,188 M1116I probably benign Het
Pitpnm2 T A 5: 124,125,356 I824F possibly damaging Het
Pla2g4c G A 7: 13,325,744 S2N possibly damaging Het
Pla2r1 A T 2: 60,427,625 probably null Het
Pole2 T C 12: 69,202,910 D521G probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rapgef2 A T 3: 79,082,627 L931Q probably damaging Het
Rassf3 G A 10: 121,413,019 Q206* probably null Het
Rnf123 T A 9: 108,069,029 T316S probably damaging Het
Rnf138 T A 18: 21,008,693 probably null Het
Sept3 G A 15: 82,289,213 A249T probably damaging Het
Slc35a4 A T 18: 36,679,616 D3V unknown Het
Sltm T A 9: 70,543,965 probably null Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Tcl1b1 A T 12: 105,164,531 D91V probably damaging Het
Tirap A T 9: 35,189,034 V118E probably damaging Het
Tlr5 T A 1: 182,974,233 Y367* probably null Het
Tmcc1 A G 6: 116,107,338 F5L probably benign Het
Tnxb A G 17: 34,716,501 M2592V probably benign Het
Trim66 T A 7: 109,460,244 E931V probably damaging Het
Ttn A G 2: 76,741,094 I26485T probably damaging Het
Veph1 C A 3: 66,158,282 V455L probably benign Het
Vmn1r125 A T 7: 21,272,825 H216L probably damaging Het
Wdr17 T A 8: 54,632,487 E1200D probably benign Het
Zbtb37 T A 1: 161,032,661 N25Y probably damaging Het
Other mutations in Pip5kl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Pip5kl1 APN 2 32583347 missense probably benign 0.12
IGL03074:Pip5kl1 APN 2 32580341 missense probably damaging 0.97
IGL03115:Pip5kl1 APN 2 32580021 missense probably damaging 1.00
IGL03235:Pip5kl1 APN 2 32578154 missense probably damaging 0.99
PIT4280001:Pip5kl1 UTSW 2 32583458 missense probably benign 0.06
R0149:Pip5kl1 UTSW 2 32578954 missense possibly damaging 0.70
R0416:Pip5kl1 UTSW 2 32583424 nonsense probably null
R1500:Pip5kl1 UTSW 2 32576679 missense probably benign 0.38
R1887:Pip5kl1 UTSW 2 32578505 missense probably damaging 1.00
R2897:Pip5kl1 UTSW 2 32583347 missense probably benign 0.12
R3824:Pip5kl1 UTSW 2 32583271 splice site probably null
R3937:Pip5kl1 UTSW 2 32579112 missense probably damaging 1.00
R5378:Pip5kl1 UTSW 2 32579094 missense probably benign 0.02
R7414:Pip5kl1 UTSW 2 32578235 missense possibly damaging 0.69
R7735:Pip5kl1 UTSW 2 32579089 missense possibly damaging 0.70
R8073:Pip5kl1 UTSW 2 32583428 missense possibly damaging 0.92
R8472:Pip5kl1 UTSW 2 32580006 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ACTTCTGGGGTAAGCACAGG -3'
(R):5'- TTACCTCTAGCAGCCAAGCTTG -3'

Sequencing Primer
(F):5'- TAAGCACAGGCACGTGGTG -3'
(R):5'- ACAGTACTTCCCAGCCTTTAAG -3'
Posted On2019-06-26