Incidental Mutation 'R7257:Dock8'
ID 564382
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Name dedicator of cytokinesis 8
Synonyms 1200017A24Rik, 5830472H07Rik, A130095G14Rik
MMRRC Submission 045318-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R7257 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 24976898-25179796 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25104449 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 710 (N710K)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
AlphaFold Q8C147
PDB Structure Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025831
AA Change: N710K

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: N710K

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Meta Mutation Damage Score 0.0790 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A T 6: 88,816,434 (GRCm39) V120E probably benign Het
Acot11 G A 4: 106,615,599 (GRCm39) T284M probably damaging Het
Adk G T 14: 21,102,739 (GRCm39) K11N probably damaging Het
Akr1c14 T A 13: 4,138,966 (GRCm39) N316K probably benign Het
AL732309.1 A T 2: 25,135,851 (GRCm39) V121D probably benign Het
Amh C A 10: 80,642,487 (GRCm39) Q257K probably benign Het
Antxrl T G 14: 33,787,806 (GRCm39) H276Q probably benign Het
Atp5po G A 16: 91,723,755 (GRCm39) T105M probably damaging Het
Atxn2 T G 5: 121,923,880 (GRCm39) N734K possibly damaging Het
B3gat3 T A 19: 8,903,102 (GRCm39) V153D probably benign Het
Brd2 A G 17: 34,332,796 (GRCm39) V528A probably damaging Het
Camk2g T C 14: 20,797,907 (GRCm39) S335G probably benign Het
Cbln2 T A 18: 86,734,859 (GRCm39) W211R probably damaging Het
Cry2 A T 2: 92,243,326 (GRCm39) I505N possibly damaging Het
Ddx55 T A 5: 124,698,784 (GRCm39) C249S possibly damaging Het
Dglucy A G 12: 100,808,997 (GRCm39) T232A probably damaging Het
Dhx32 A G 7: 133,361,206 (GRCm39) Y76H probably benign Het
Dmac2l T C 12: 69,788,443 (GRCm39) I114T probably damaging Het
Dock7 T A 4: 98,861,649 (GRCm39) N1356I unknown Het
Dync1i2 T A 2: 71,079,700 (GRCm39) N391K possibly damaging Het
Ect2 A G 3: 27,192,684 (GRCm39) S420P probably damaging Het
Efcab5 T A 11: 77,028,605 (GRCm39) E242V probably damaging Het
Fam83g T A 11: 61,575,579 (GRCm39) Y74N probably damaging Het
Fbxo34 T A 14: 47,738,329 (GRCm39) probably null Het
Flt4 A G 11: 49,516,836 (GRCm39) T208A probably benign Het
Fxyd5 T A 7: 30,734,576 (GRCm39) H183L unknown Het
Gpr150 T G 13: 76,204,585 (GRCm39) D120A probably benign Het
Grm7 A G 6: 110,623,079 (GRCm39) Y84C probably damaging Het
Ighmbp2 A G 19: 3,316,405 (GRCm39) S562P probably damaging Het
Itga7 A G 10: 128,780,282 (GRCm39) Y530C possibly damaging Het
Itpr3 T A 17: 27,337,535 (GRCm39) D2448E probably benign Het
Mmp17 C A 5: 129,672,697 (GRCm39) H216Q probably benign Het
Mns1 C T 9: 72,360,097 (GRCm39) R416W probably damaging Het
Mog A G 17: 37,334,019 (GRCm39) S25P unknown Het
Myh2 A G 11: 67,071,976 (GRCm39) K568R possibly damaging Het
Myh7 A T 14: 55,209,947 (GRCm39) probably null Het
Mymk A T 2: 26,957,380 (GRCm39) W79R probably damaging Het
Ncoa4 T G 14: 31,899,326 (GRCm39) L623R probably damaging Het
Oca2 G A 7: 55,929,286 (GRCm39) probably benign Het
Odam A C 5: 88,035,404 (GRCm39) S123R probably benign Het
Or14c39 T A 7: 86,344,012 (GRCm39) M116K probably damaging Het
Or2w1 A G 13: 21,317,427 (GRCm39) T161A probably benign Het
Or51f1d T C 7: 102,700,837 (GRCm39) F111L probably benign Het
Or5d16 A G 2: 87,773,915 (GRCm39) F19S probably damaging Het
Or6c69 T A 10: 129,748,156 (GRCm39) probably benign Het
Or6c8b C T 10: 128,882,324 (GRCm39) V203M probably benign Het
Ovch2 C T 7: 107,393,640 (GRCm39) C162Y probably damaging Het
Padi1 C A 4: 140,556,782 (GRCm39) G142C probably damaging Het
Pcdhga4 A G 18: 37,820,451 (GRCm39) I667V probably damaging Het
Pfas A T 11: 68,883,785 (GRCm39) V624E probably damaging Het
Phb1 A T 11: 95,568,917 (GRCm39) E184V probably damaging Het
Phlpp2 G T 8: 110,666,820 (GRCm39) M1116I probably benign Het
Pip5kl1 T C 2: 32,470,443 (GRCm39) probably null Het
Pitpnm2 T A 5: 124,263,419 (GRCm39) I824F possibly damaging Het
Pla2g4c G A 7: 13,059,669 (GRCm39) S2N possibly damaging Het
Pla2r1 A T 2: 60,257,969 (GRCm39) probably null Het
Pole2 T C 12: 69,249,684 (GRCm39) D521G probably damaging Het
Ptch1 T C 13: 63,721,108 (GRCm39) K54E not run Het
Rapgef2 A T 3: 78,989,934 (GRCm39) L931Q probably damaging Het
Rassf3 G A 10: 121,248,924 (GRCm39) Q206* probably null Het
Rnf123 T A 9: 107,946,228 (GRCm39) T316S probably damaging Het
Rnf138 T A 18: 21,141,750 (GRCm39) probably null Het
Septin3 G A 15: 82,173,414 (GRCm39) A249T probably damaging Het
Slc35a4 A T 18: 36,812,669 (GRCm39) D3V unknown Het
Sltm T A 9: 70,451,247 (GRCm39) probably null Het
Smarca2 C T 19: 26,631,864 (GRCm39) Q560* probably null Het
Tcl1b1 A T 12: 105,130,790 (GRCm39) D91V probably damaging Het
Tirap A T 9: 35,100,330 (GRCm39) V118E probably damaging Het
Tlr5 T A 1: 182,801,798 (GRCm39) Y367* probably null Het
Tmcc1 A G 6: 116,084,299 (GRCm39) F5L probably benign Het
Tnxb A G 17: 34,935,475 (GRCm39) M2592V probably benign Het
Trim66 T A 7: 109,059,451 (GRCm39) E931V probably damaging Het
Ttn A G 2: 76,571,438 (GRCm39) I26485T probably damaging Het
Veph1 C A 3: 66,065,703 (GRCm39) V455L probably benign Het
Vmn1r125 A T 7: 21,006,750 (GRCm39) H216L probably damaging Het
Wdr17 T A 8: 55,085,522 (GRCm39) E1200D probably benign Het
Zbtb37 T A 1: 160,860,231 (GRCm39) N25Y probably damaging Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25,105,076 (GRCm39) critical splice donor site probably benign
primurus APN 19 25,160,973 (GRCm39) missense probably damaging 1.00
IGL00737:Dock8 APN 19 25,160,340 (GRCm39) missense probably benign 0.00
IGL00755:Dock8 APN 19 25,028,873 (GRCm39) missense probably benign 0.09
IGL00822:Dock8 APN 19 25,165,773 (GRCm39) nonsense probably null
IGL00838:Dock8 APN 19 25,152,823 (GRCm39) nonsense probably null
IGL01419:Dock8 APN 19 25,096,816 (GRCm39) missense probably benign 0.08
IGL01456:Dock8 APN 19 25,096,863 (GRCm39) missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25,146,805 (GRCm39) missense probably damaging 0.99
IGL01602:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01605:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01753:Dock8 APN 19 25,038,656 (GRCm39) splice site probably benign
IGL01843:Dock8 APN 19 25,067,292 (GRCm39) missense probably benign 0.02
IGL02032:Dock8 APN 19 25,107,769 (GRCm39) missense probably damaging 0.99
IGL02073:Dock8 APN 19 25,178,350 (GRCm39) critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25,055,569 (GRCm39) critical splice donor site probably null
IGL02402:Dock8 APN 19 25,055,509 (GRCm39) missense probably benign 0.25
IGL02529:Dock8 APN 19 25,078,290 (GRCm39) nonsense probably null
IGL02728:Dock8 APN 19 25,109,584 (GRCm39) missense probably benign
IGL02739:Dock8 APN 19 25,165,852 (GRCm39) missense probably damaging 1.00
IGL03037:Dock8 APN 19 25,063,545 (GRCm39) missense probably benign 0.02
IGL03104:Dock8 APN 19 25,178,384 (GRCm39) nonsense probably null
IGL03137:Dock8 APN 19 25,133,312 (GRCm39) missense probably benign 0.19
IGL03365:Dock8 APN 19 25,077,048 (GRCm39) missense possibly damaging 0.70
Defenseless UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
Guardate UTSW 19 25,127,195 (GRCm39) missense probably benign
hillock UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
Molehill UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
Pap UTSW 19 25,099,805 (GRCm39) missense probably benign 0.31
Papilla UTSW 19 25,055,448 (GRCm39) nonsense probably null
snowdrop UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
warts_and_all UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R0021:Dock8 UTSW 19 25,140,411 (GRCm39) missense probably benign 0.01
R0147:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0148:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0294:Dock8 UTSW 19 25,165,714 (GRCm39) missense probably damaging 1.00
R0537:Dock8 UTSW 19 25,148,941 (GRCm39) missense probably benign 0.08
R0630:Dock8 UTSW 19 25,038,524 (GRCm39) missense probably benign 0.10
R1163:Dock8 UTSW 19 25,028,867 (GRCm39) missense probably benign
R1164:Dock8 UTSW 19 25,067,391 (GRCm39) missense probably benign 0.44
R1471:Dock8 UTSW 19 25,178,400 (GRCm39) missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
R1803:Dock8 UTSW 19 25,109,599 (GRCm39) missense probably benign 0.00
R1822:Dock8 UTSW 19 25,138,422 (GRCm39) missense probably benign 0.31
R1852:Dock8 UTSW 19 25,104,492 (GRCm39) missense probably benign 0.45
R1916:Dock8 UTSW 19 25,038,521 (GRCm39) missense probably benign 0.02
R1984:Dock8 UTSW 19 25,098,545 (GRCm39) missense probably null
R2311:Dock8 UTSW 19 25,160,368 (GRCm39) missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25,177,757 (GRCm39) missense probably damaging 0.99
R2483:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3116:Dock8 UTSW 19 25,165,858 (GRCm39) missense probably benign 0.00
R3157:Dock8 UTSW 19 25,127,195 (GRCm39) missense probably benign
R3623:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3624:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3800:Dock8 UTSW 19 25,141,716 (GRCm39) missense probably benign 0.08
R3844:Dock8 UTSW 19 25,042,794 (GRCm39) nonsense probably null
R3895:Dock8 UTSW 19 25,028,865 (GRCm39) missense probably benign 0.31
R3901:Dock8 UTSW 19 25,078,269 (GRCm39) missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
R4428:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4428:Dock8 UTSW 19 25,177,863 (GRCm39) missense probably damaging 0.98
R4429:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4431:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4545:Dock8 UTSW 19 25,165,722 (GRCm39) missense probably damaging 1.00
R4839:Dock8 UTSW 19 25,146,858 (GRCm39) missense probably benign 0.00
R4897:Dock8 UTSW 19 25,159,001 (GRCm39) missense probably benign 0.00
R4939:Dock8 UTSW 19 25,099,764 (GRCm39) missense probably damaging 1.00
R4995:Dock8 UTSW 19 25,135,747 (GRCm39) missense probably benign 0.02
R5035:Dock8 UTSW 19 25,063,571 (GRCm39) missense probably damaging 0.99
R5294:Dock8 UTSW 19 25,038,517 (GRCm39) missense probably benign 0.01
R5324:Dock8 UTSW 19 25,140,458 (GRCm39) missense probably benign 0.17
R5478:Dock8 UTSW 19 25,057,186 (GRCm39) missense probably benign
R5704:Dock8 UTSW 19 25,151,586 (GRCm39) missense probably damaging 1.00
R5724:Dock8 UTSW 19 25,099,785 (GRCm39) missense probably damaging 1.00
R5745:Dock8 UTSW 19 25,107,761 (GRCm39) missense probably benign 0.02
R5864:Dock8 UTSW 19 25,038,584 (GRCm39) missense probably damaging 0.99
R5870:Dock8 UTSW 19 25,109,490 (GRCm39) missense probably benign
R5893:Dock8 UTSW 19 25,099,811 (GRCm39) missense probably damaging 1.00
R5954:Dock8 UTSW 19 25,148,983 (GRCm39) missense probably damaging 1.00
R6087:Dock8 UTSW 19 25,138,438 (GRCm39) missense probably benign 0.00
R6223:Dock8 UTSW 19 25,138,416 (GRCm39) missense probably benign 0.00
R6391:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25,104,848 (GRCm39) missense probably damaging 0.99
R6786:Dock8 UTSW 19 25,160,386 (GRCm39) missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25,099,805 (GRCm39) missense probably benign 0.31
R6818:Dock8 UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R6885:Dock8 UTSW 19 25,124,742 (GRCm39) missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25,165,746 (GRCm39) missense probably damaging 1.00
R6923:Dock8 UTSW 19 25,072,970 (GRCm39) missense probably benign
R7001:Dock8 UTSW 19 25,077,041 (GRCm39) missense probably benign
R7141:Dock8 UTSW 19 25,158,984 (GRCm39) missense probably null 0.75
R7203:Dock8 UTSW 19 25,158,927 (GRCm39) missense probably damaging 1.00
R7296:Dock8 UTSW 19 25,162,245 (GRCm39) missense probably benign 0.00
R7538:Dock8 UTSW 19 25,135,782 (GRCm39) missense probably damaging 1.00
R7555:Dock8 UTSW 19 25,152,764 (GRCm39) missense probably damaging 0.99
R7641:Dock8 UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
R7764:Dock8 UTSW 19 25,074,899 (GRCm39) missense probably benign
R7859:Dock8 UTSW 19 25,160,934 (GRCm39) missense probably damaging 1.00
R7864:Dock8 UTSW 19 25,140,864 (GRCm39) missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25,131,606 (GRCm39) missense probably damaging 1.00
R8160:Dock8 UTSW 19 25,124,711 (GRCm39) missense probably damaging 1.00
R8287:Dock8 UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
R8295:Dock8 UTSW 19 25,100,600 (GRCm39) missense probably benign 0.04
R8443:Dock8 UTSW 19 25,133,281 (GRCm39) missense probably benign 0.04
R8537:Dock8 UTSW 19 25,107,870 (GRCm39) missense probably benign 0.00
R8673:Dock8 UTSW 19 25,160,867 (GRCm39) missense probably damaging 0.96
R8709:Dock8 UTSW 19 25,055,448 (GRCm39) nonsense probably null
R8834:Dock8 UTSW 19 25,140,834 (GRCm39) missense probably benign 0.16
R8991:Dock8 UTSW 19 25,165,731 (GRCm39) missense possibly damaging 0.82
R9292:Dock8 UTSW 19 25,160,995 (GRCm39) splice site probably benign
R9509:Dock8 UTSW 19 25,072,985 (GRCm39) missense probably benign 0.00
R9526:Dock8 UTSW 19 25,165,739 (GRCm39) missense probably benign 0.10
R9622:Dock8 UTSW 19 25,098,545 (GRCm39) missense probably null
R9634:Dock8 UTSW 19 25,169,585 (GRCm39) missense probably damaging 1.00
R9654:Dock8 UTSW 19 25,124,710 (GRCm39) missense probably damaging 1.00
R9670:Dock8 UTSW 19 25,148,926 (GRCm39) missense probably null 0.01
R9699:Dock8 UTSW 19 25,133,388 (GRCm39) critical splice donor site probably null
R9726:Dock8 UTSW 19 25,154,374 (GRCm39) missense probably damaging 0.97
R9765:Dock8 UTSW 19 25,146,832 (GRCm39) missense possibly damaging 0.94
X0027:Dock8 UTSW 19 25,138,493 (GRCm39) missense probably benign
Z1177:Dock8 UTSW 19 25,133,336 (GRCm39) missense probably benign 0.16
Z1177:Dock8 UTSW 19 25,109,487 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGACAAAGGCCTCTGACTCC -3'
(R):5'- GGTATACAACATAGGACCTTTTGAC -3'

Sequencing Primer
(F):5'- TCCCAAGTCTAGCTATGGACG -3'
(R):5'- CTCCAACTCATGCTGTAGGTAGG -3'
Posted On 2019-06-26