Mutagenetix > Incidental Mutation

Incidental Mutation 'R7257:Atxn2'

564326

Institutional Source

Beutler Lab

Gene Symbol

Atxn2

Ensembl Gene

ENSMUSG00000042605

Gene Name

ataxin 2

Synonyms

9630045M23Rik, ATX2, Sca2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.716) question?

Stock #

R7257 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121711337-121816493 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 121785817 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 734 (N734K)

Ref Sequence

ENSEMBL: ENSMUSP00000056715 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051950] [ENSMUST00000161064] [ENSMUST00000162327] [ENSMUST00000225761]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000051950
AA Change: N734K

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605
AA Change: N734K

Domain	Start	End	E-Value	Type
low complexity region	32	42	N/A	INTRINSIC
low complexity region	46	69	N/A	INTRINSIC
low complexity region	93	116	N/A	INTRINSIC
low complexity region	128	144	N/A	INTRINSIC
low complexity region	168	219	N/A	INTRINSIC
Pfam:SM-ATX	236	307	6.4e-23	PFAM
LsmAD	378	446	8.57e-25	SMART
low complexity region	520	540	N/A	INTRINSIC
low complexity region	544	576	N/A	INTRINSIC
low complexity region	685	705	N/A	INTRINSIC
low complexity region	807	838	N/A	INTRINSIC
low complexity region	864	879	N/A	INTRINSIC
Pfam:PAM2	880	897	5.7e-9	PFAM
low complexity region	1128	1165	N/A	INTRINSIC
low complexity region	1185	1196	N/A	INTRINSIC
low complexity region	1245	1261	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000125647
Gene: ENSMUSG00000042605
AA Change: N265K

Domain	Start	End	E-Value	Type
Pfam:LsmAD	1	47	3.6e-11	PFAM
low complexity region	217	237	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161064
AA Change: N425K

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605
AA Change: N425K

Domain	Start	End	E-Value	Type
LsmAD	69	137	8.57e-25	SMART
low complexity region	211	231	N/A	INTRINSIC
low complexity region	235	267	N/A	INTRINSIC
low complexity region	376	396	N/A	INTRINSIC
low complexity region	498	529	N/A	INTRINSIC
low complexity region	555	570	N/A	INTRINSIC
Pfam:PAM2	571	588	3.5e-9	PFAM
low complexity region	801	838	N/A	INTRINSIC
low complexity region	858	869	N/A	INTRINSIC
low complexity region	915	923	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162327
AA Change: N130K

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605
AA Change: N130K

Domain	Start	End	E-Value	Type
low complexity region	1	32	N/A	INTRINSIC
low complexity region	58	73	N/A	INTRINSIC
Pfam:PAM2	74	91	1.3e-9	PFAM
low complexity region	302	339	N/A	INTRINSIC
low complexity region	359	370	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000225761

Meta Mutation Damage Score

0.0599

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mice exhibit an enlarged fat pad, hepatic steatosis and enlarged seminal vesicles. A mild defect in motor learning is seen, but no other notable behavioral or neurological defects are detectable. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb1	A	T	6: 88,839,452	V120E	probably benign	Het
Acot11	G	A	4: 106,758,402	T284M	probably damaging	Het
Adk	G	T	14: 21,052,671	K11N	probably damaging	Het
Akr1c14	T	A	13: 4,088,966	N316K	probably benign	Het
AL732309.1	A	T	2: 25,245,839	V121D	probably benign	Het
Amh	C	A	10: 80,806,653	Q257K	probably benign	Het
Antxrl	T	G	14: 34,065,849	H276Q	probably benign	Het
Atp5o	G	A	16: 91,926,867	T105M	probably damaging	Het
Atp5s	T	C	12: 69,741,669	I114T	probably damaging	Het
B3gat3	T	A	19: 8,925,738	V153D	probably benign	Het
Brd2	A	G	17: 34,113,822	V528A	probably damaging	Het
Camk2g	T	C	14: 20,747,839	S335G	probably benign	Het
Cbln2	T	A	18: 86,716,734	W211R	probably damaging	Het
Cry2	A	T	2: 92,412,981	I505N	possibly damaging	Het
Ddx55	T	A	5: 124,560,721	C249S	possibly damaging	Het
Dglucy	A	G	12: 100,842,738	T232A	probably damaging	Het
Dhx32	A	G	7: 133,759,477	Y76H	probably benign	Het
Dock7	T	A	4: 98,973,412	N1356I	unknown	Het
Dock8	T	A	19: 25,127,085	N710K	probably benign	Het
Dync1i2	T	A	2: 71,249,356	N391K	possibly damaging	Het
Ect2	A	G	3: 27,138,535	S420P	probably damaging	Het
Efcab5	T	A	11: 77,137,779	E242V	probably damaging	Het
Fam83g	T	A	11: 61,684,753	Y74N	probably damaging	Het
Fbxo34	T	A	14: 47,500,872		probably null	Het
Flt4	A	G	11: 49,626,009	T208A	probably benign	Het
Fxyd5	T	A	7: 31,035,151	H183L	unknown	Het
Gpr150	T	G	13: 76,056,466	D120A	probably benign	Het
Grm7	A	G	6: 110,646,118	Y84C	probably damaging	Het
Ighmbp2	A	G	19: 3,266,405	S562P	probably damaging	Het
Itga7	A	G	10: 128,944,413	Y530C	possibly damaging	Het
Itpr3	T	A	17: 27,118,561	D2448E	probably benign	Het
Mmp17	C	A	5: 129,595,633	H216Q	probably benign	Het
Mns1	C	T	9: 72,452,815	R416W	probably damaging	Het
Mog	A	G	17: 37,023,127	S25P	unknown	Het
Myh2	A	G	11: 67,181,150	K568R	possibly damaging	Het
Myh7	A	T	14: 54,972,490		probably null	Het
Mymk	A	T	2: 27,067,368	W79R	probably damaging	Het
Ncoa4	T	G	14: 32,177,369	L623R	probably damaging	Het
Oca2	G	A	7: 56,279,538		probably benign	Het
Odam	A	C	5: 87,887,545	S123R	probably benign	Het
Olfr1155	A	G	2: 87,943,571	F19S	probably damaging	Het
Olfr263	A	G	13: 21,133,257	T161A	probably benign	Het
Olfr292	T	A	7: 86,694,804	M116K	probably damaging	Het
Olfr583	T	C	7: 103,051,630	F111L	probably benign	Het
Olfr765	C	T	10: 129,046,455	V203M	probably benign	Het
Olfr816	T	A	10: 129,912,287		probably benign	Het
Ovch2	C	T	7: 107,794,433	C162Y	probably damaging	Het
Padi1	C	A	4: 140,829,471	G142C	probably damaging	Het
Pcdhga4	A	G	18: 37,687,398	I667V	probably damaging	Het
Pfas	A	T	11: 68,992,959	V624E	probably damaging	Het
Phb	A	T	11: 95,678,091	E184V	probably damaging	Het
Phlpp2	G	T	8: 109,940,188	M1116I	probably benign	Het
Pip5kl1	T	C	2: 32,580,431		probably null	Het
Pitpnm2	T	A	5: 124,125,356	I824F	possibly damaging	Het
Pla2g4c	G	A	7: 13,325,744	S2N	possibly damaging	Het
Pla2r1	A	T	2: 60,427,625		probably null	Het
Pole2	T	C	12: 69,202,910	D521G	probably damaging	Het
Ptch1	T	C	13: 63,573,294	K54E	not run	Het
Rapgef2	A	T	3: 79,082,627	L931Q	probably damaging	Het
Rassf3	G	A	10: 121,413,019	Q206*	probably null	Het
Rnf123	T	A	9: 108,069,029	T316S	probably damaging	Het
Rnf138	T	A	18: 21,008,693		probably null	Het
Sept3	G	A	15: 82,289,213	A249T	probably damaging	Het
Slc35a4	A	T	18: 36,679,616	D3V	unknown	Het
Sltm	T	A	9: 70,543,965		probably null	Het
Smarca2	C	T	19: 26,654,464	Q560*	probably null	Het
Tcl1b1	A	T	12: 105,164,531	D91V	probably damaging	Het
Tirap	A	T	9: 35,189,034	V118E	probably damaging	Het
Tlr5	T	A	1: 182,974,233	Y367*	probably null	Het
Tmcc1	A	G	6: 116,107,338	F5L	probably benign	Het
Tnxb	A	G	17: 34,716,501	M2592V	probably benign	Het
Trim66	T	A	7: 109,460,244	E931V	probably damaging	Het
Ttn	A	G	2: 76,741,094	I26485T	probably damaging	Het
Veph1	C	A	3: 66,158,282	V455L	probably benign	Het
Vmn1r125	A	T	7: 21,272,825	H216L	probably damaging	Het
Wdr17	T	A	8: 54,632,487	E1200D	probably benign	Het
Zbtb37	T	A	1: 161,032,661	N25Y	probably damaging	Het

Other mutations in Atxn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00656:Atxn2	APN	5	121795055	missense	probably benign	0.00
IGL00798:Atxn2	APN	5	121795235	missense	possibly damaging	0.58
IGL01518:Atxn2	APN	5	121810979	missense	probably damaging	1.00
IGL01737:Atxn2	APN	5	121797344	missense	probably damaging	0.98
IGL01832:Atxn2	APN	5	121806268	nonsense	probably null
IGL02122:Atxn2	APN	5	121778030	missense	probably damaging	1.00
IGL02333:Atxn2	APN	5	121781387	missense	probably damaging	1.00
IGL02742:Atxn2	APN	5	121781336	missense	possibly damaging	0.75
IGL03028:Atxn2	APN	5	121810909	missense	probably damaging	1.00
IGL03282:Atxn2	APN	5	121785235	missense	probably benign	0.00
R0387:Atxn2	UTSW	5	121802143	missense	possibly damaging	0.83
R0653:Atxn2	UTSW	5	121772778	missense	probably damaging	0.99
R0849:Atxn2	UTSW	5	121747421	splice site	probably null
R1305:Atxn2	UTSW	5	121749184	missense	probably damaging	1.00
R1440:Atxn2	UTSW	5	121803082	critical splice donor site	probably null
R1471:Atxn2	UTSW	5	121786374	missense	probably damaging	1.00
R1521:Atxn2	UTSW	5	121779591	missense	probably damaging	1.00
R1528:Atxn2	UTSW	5	121802108	missense	probably damaging	0.99
R1528:Atxn2	UTSW	5	121813530	missense	probably damaging	1.00
R2083:Atxn2	UTSW	5	121784006	missense	probably benign	0.00
R2197:Atxn2	UTSW	5	121806217	splice site	probably null
R2217:Atxn2	UTSW	5	121803077	missense	probably damaging	1.00
R2218:Atxn2	UTSW	5	121803077	missense	probably damaging	1.00
R2420:Atxn2	UTSW	5	121802079	critical splice acceptor site	probably null
R2421:Atxn2	UTSW	5	121802079	critical splice acceptor site	probably null
R2510:Atxn2	UTSW	5	121781393	missense	probably damaging	1.00
R3706:Atxn2	UTSW	5	121785868	critical splice donor site	probably null
R4604:Atxn2	UTSW	5	121781343	missense	probably damaging	1.00
R4852:Atxn2	UTSW	5	121814411	missense	probably damaging	0.97
R4914:Atxn2	UTSW	5	121749096	missense	probably damaging	1.00
R4982:Atxn2	UTSW	5	121814343	missense	possibly damaging	0.66
R5172:Atxn2	UTSW	5	121795035	splice site	probably null
R5213:Atxn2	UTSW	5	121814480	splice site	probably null
R5655:Atxn2	UTSW	5	121747426	missense	probably damaging	0.97
R5775:Atxn2	UTSW	5	121813449	missense	probably damaging	1.00
R5782:Atxn2	UTSW	5	121797310	missense	probably damaging	1.00
R6015:Atxn2	UTSW	5	121810992	missense	probably damaging	1.00
R6438:Atxn2	UTSW	5	121779432	missense	probably damaging	1.00
R6529:Atxn2	UTSW	5	121811614	critical splice donor site	probably null
R6659:Atxn2	UTSW	5	121777964	missense	probably benign	0.10
R6864:Atxn2	UTSW	5	121779494	missense	probably damaging	1.00
R7035:Atxn2	UTSW	5	121811467	nonsense	probably null
R7166:Atxn2	UTSW	5	121796397	missense	possibly damaging	0.90
R7253:Atxn2	UTSW	5	121778021	missense	probably damaging	1.00
R7467:Atxn2	UTSW	5	121802267	critical splice donor site	probably null
R7544:Atxn2	UTSW	5	121781368	missense	probably damaging	1.00
R7648:Atxn2	UTSW	5	121796377	missense	probably damaging	0.99
R7883:Atxn2	UTSW	5	121802117	missense	possibly damaging	0.79
R8097:Atxn2	UTSW	5	121749223	missense	probably damaging	1.00
R8784:Atxn2	UTSW	5	121795028	missense	probably benign	0.00
R8835:Atxn2	UTSW	5	121802185	missense	possibly damaging	0.63
R8880:Atxn2	UTSW	5	121810910	missense	probably benign	0.24
R8983:Atxn2	UTSW	5	121778000	missense	probably damaging	1.00
R9254:Atxn2	UTSW	5	121747446	missense	probably damaging	1.00
R9332:Atxn2	UTSW	5	121785362	missense	probably damaging	1.00
R9379:Atxn2	UTSW	5	121747446	missense	probably damaging	1.00
R9412:Atxn2	UTSW	5	121802138	missense	possibly damaging	0.84
X0028:Atxn2	UTSW	5	121802083	missense	probably benign	0.01
Z1176:Atxn2	UTSW	5	121777990	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAACCCATTTTCCCCTAAGC -3'
(R):5'- ATGCAAGTATCTGTCTGGCTAAAC -3'

Sequencing Primer
(F):5'- TTTTCCCCTAAGCCAGAAGG -3'
(R):5'- CATGGTGGCTCACAACCATCTG -3'

Posted On

2019-06-26