Incidental Mutation 'R7350:Prr35'
ID 570538
Institutional Source Beutler Lab
Gene Symbol Prr35
Ensembl Gene ENSMUSG00000025727
Gene Name proline rich 35
Synonyms A930017K11Rik
MMRRC Submission 045436-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7350 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 26165361-26171539 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 26165685 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 534 (V534D)
Ref Sequence ENSEMBL: ENSMUSP00000125106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026823] [ENSMUST00000085027] [ENSMUST00000097368] [ENSMUST00000139226] [ENSMUST00000140304] [ENSMUST00000145745] [ENSMUST00000148307] [ENSMUST00000148382] [ENSMUST00000162431] [ENSMUST00000181174] [ENSMUST00000208043] [ENSMUST00000208071]
AlphaFold E0CXQ2
Predicted Effect probably benign
Transcript: ENSMUST00000026823
SMART Domains Protein: ENSMUSP00000026823
Gene: ENSMUSG00000025728

DomainStartEndE-ValueType
low complexity region 214 228 N/A INTRINSIC
Pfam:Gpi1 274 463 5.1e-79 PFAM
transmembrane domain 478 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085027
SMART Domains Protein: ENSMUSP00000082102
Gene: ENSMUSG00000090113

DomainStartEndE-ValueType
Pfam:NHL 61 88 8.4e-8 PFAM
SCOP:d1crua_ 89 129 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097368
SMART Domains Protein: ENSMUSP00000094981
Gene: ENSMUSG00000025728

DomainStartEndE-ValueType
low complexity region 214 228 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
Pfam:Gpi1 365 523 8.6e-66 PFAM
transmembrane domain 538 560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139226
SMART Domains Protein: ENSMUSP00000115447
Gene: ENSMUSG00000025728

DomainStartEndE-ValueType
low complexity region 214 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140304
Predicted Effect probably benign
Transcript: ENSMUST00000145745
Predicted Effect probably benign
Transcript: ENSMUST00000148307
Predicted Effect probably benign
Transcript: ENSMUST00000148382
Predicted Effect probably damaging
Transcript: ENSMUST00000162431
AA Change: V534D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125106
Gene: ENSMUSG00000025727
AA Change: V534D

DomainStartEndE-ValueType
Pfam:zf-C2H2_7 17 70 4.3e-40 PFAM
low complexity region 77 90 N/A INTRINSIC
low complexity region 117 137 N/A INTRINSIC
low complexity region 158 170 N/A INTRINSIC
low complexity region 229 249 N/A INTRINSIC
low complexity region 294 311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181174
Predicted Effect probably benign
Transcript: ENSMUST00000208043
Predicted Effect probably benign
Transcript: ENSMUST00000208071
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas2 T C 7: 132,476,578 (GRCm39) F106S probably damaging Het
Acsf3 A G 8: 123,512,685 (GRCm39) T369A probably benign Het
Adgrf5 G A 17: 43,739,335 (GRCm39) probably null Het
Aff1 T A 5: 103,994,958 (GRCm39) I1052K probably benign Het
Akap8 T C 17: 32,535,549 (GRCm39) D155G possibly damaging Het
Alg10b A T 15: 90,111,653 (GRCm39) M166L probably benign Het
Allc T A 12: 28,613,408 (GRCm39) Q178L possibly damaging Het
Angptl4 C A 17: 33,996,084 (GRCm39) L297F probably damaging Het
Arfgap1 A G 2: 180,612,869 (GRCm39) K8E possibly damaging Het
Bckdhb T A 9: 83,892,379 (GRCm39) V270E possibly damaging Het
Cbx3 T C 6: 51,452,355 (GRCm39) probably null Het
Cd44 G T 2: 102,664,607 (GRCm39) N531K probably benign Het
Cdh23 A T 10: 60,246,689 (GRCm39) D916E probably damaging Het
Cr2 A G 1: 194,837,594 (GRCm39) V792A probably benign Het
Cstf3 T C 2: 104,439,301 (GRCm39) L38P probably damaging Het
Cyp2a5 A G 7: 26,536,208 (GRCm39) E151G probably benign Het
Dbr1 T C 9: 99,464,602 (GRCm39) F127S Het
Ddit4 A T 10: 59,787,317 (GRCm39) D6E probably damaging Het
Disc1 G C 8: 125,891,841 (GRCm39) R631S probably damaging Het
Dnah5 T A 15: 28,235,965 (GRCm39) probably null Het
Dnah9 T C 11: 65,971,404 (GRCm39) K1595E probably damaging Het
Dnmbp T C 19: 43,889,944 (GRCm39) R608G probably damaging Het
Efcab5 G C 11: 77,028,387 (GRCm39) P315A probably benign Het
Eif4a2 A G 16: 22,932,012 (GRCm39) Y392C possibly damaging Het
F5 G T 1: 164,020,277 (GRCm39) K917N probably benign Het
Fig4 T C 10: 41,127,752 (GRCm39) M571V probably benign Het
Flot2 T A 11: 77,948,802 (GRCm39) I259N probably damaging Het
Gm8122 C A 14: 43,088,058 (GRCm39) probably null Het
Gpr152 T C 19: 4,192,963 (GRCm39) V168A possibly damaging Het
H1f0 G A 15: 78,913,103 (GRCm39) G61D probably damaging Het
Ihh T A 1: 74,987,492 (GRCm39) K183M probably damaging Het
Itga2 A G 13: 114,973,738 (GRCm39) L1116P probably damaging Het
Kcnj10 A G 1: 172,196,827 (GRCm39) T114A possibly damaging Het
Kcnk3 T G 5: 30,779,310 (GRCm39) L120R probably damaging Het
Krt14 C A 11: 100,095,926 (GRCm39) E211* probably null Het
Lars2 T C 9: 123,256,545 (GRCm39) L350P probably damaging Het
Lrba T C 3: 86,259,209 (GRCm39) I1408T probably damaging Het
Lrrc27 A G 7: 138,806,022 (GRCm39) E229G probably benign Het
Lrrc8e G T 8: 4,285,626 (GRCm39) R617L probably benign Het
M1ap A G 6: 82,958,930 (GRCm39) D187G probably benign Het
Marchf1 A T 8: 66,921,051 (GRCm39) K243* probably null Het
Med16 C T 10: 79,739,031 (GRCm39) V252M probably damaging Het
Micu3 T C 8: 40,801,999 (GRCm39) S189P probably benign Het
Mier2 C A 10: 79,376,132 (GRCm39) M264I unknown Het
Mindy4 A T 6: 55,278,010 (GRCm39) N618I probably damaging Het
Mmrn1 C T 6: 60,953,320 (GRCm39) Q534* probably null Het
Mroh9 C T 1: 162,903,858 (GRCm39) probably null Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Mta3 T A 17: 84,015,870 (GRCm39) I24N probably damaging Het
Mtmr4 A T 11: 87,491,476 (GRCm39) H147L probably damaging Het
Nfam1 T C 15: 82,894,640 (GRCm39) K155R probably benign Het
Nlrp6 A T 7: 140,501,191 (GRCm39) probably benign Het
Or1q1 T A 2: 36,886,873 (GRCm39) I17N possibly damaging Het
Or5d37 A T 2: 87,923,542 (GRCm39) F246Y probably benign Het
Or5w20 T C 2: 87,726,753 (GRCm39) probably benign Het
Or6d13 A G 6: 116,517,495 (GRCm39) E27G probably benign Het
Or9g4 A G 2: 85,505,189 (GRCm39) F102S Het
P4ha1 A G 10: 59,186,240 (GRCm39) R240G probably damaging Het
Pla2r1 G T 2: 60,288,723 (GRCm39) D636E probably benign Het
Polr2a A G 11: 69,631,886 (GRCm39) L1060P possibly damaging Het
Ptgdr2 C A 19: 10,918,319 (GRCm39) Q279K probably benign Het
Rab11fip2 T A 19: 59,925,853 (GRCm39) R121S probably benign Het
Rasa2 T C 9: 96,426,408 (GRCm39) S813G probably benign Het
Rassf5 T C 1: 131,106,273 (GRCm39) K411E possibly damaging Het
Reep4 T C 14: 70,783,987 (GRCm39) Y35H probably damaging Het
Ror1 A T 4: 100,283,140 (GRCm39) M402L probably benign Het
Slc32a1 A G 2: 158,456,326 (GRCm39) E327G probably damaging Het
Spen C T 4: 141,206,696 (GRCm39) E644K unknown Het
Tars3 C G 7: 65,308,672 (GRCm39) Q281E probably damaging Het
Tcl1 A G 12: 105,184,934 (GRCm39) I92T probably damaging Het
Tifab A G 13: 56,324,120 (GRCm39) S108P probably damaging Het
Traf1 T C 2: 34,838,245 (GRCm39) N198D probably benign Het
Trim35 T C 14: 66,546,654 (GRCm39) Y474H probably damaging Het
Trim54 T A 5: 31,294,505 (GRCm39) D344E probably benign Het
Ttc28 A T 5: 111,373,903 (GRCm39) H1113L probably damaging Het
Vcam1 T A 3: 115,908,211 (GRCm39) D617V probably damaging Het
Vmn2r81 A T 10: 79,104,219 (GRCm39) T281S probably benign Het
Whrn C T 4: 63,350,196 (GRCm39) R507K possibly damaging Het
Zdhhc14 A G 17: 5,777,151 (GRCm39) S303G probably benign Het
Zfp292 A T 4: 34,806,839 (GRCm39) N2073K probably benign Het
Zgpat T A 2: 181,022,228 (GRCm39) V163D Het
Other mutations in Prr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02035:Prr35 APN 17 26,166,136 (GRCm39) missense probably benign 0.02
R0042:Prr35 UTSW 17 26,166,956 (GRCm39) nonsense probably null
R0042:Prr35 UTSW 17 26,166,956 (GRCm39) nonsense probably null
R0558:Prr35 UTSW 17 26,166,523 (GRCm39) missense probably benign 0.00
R0856:Prr35 UTSW 17 26,167,001 (GRCm39) missense probably benign
R1623:Prr35 UTSW 17 26,166,508 (GRCm39) missense probably benign 0.01
R1830:Prr35 UTSW 17 26,165,691 (GRCm39) missense possibly damaging 0.95
R2173:Prr35 UTSW 17 26,167,461 (GRCm39) missense probably damaging 1.00
R6726:Prr35 UTSW 17 26,166,689 (GRCm39) missense probably benign 0.17
R7369:Prr35 UTSW 17 26,166,934 (GRCm39) missense probably damaging 1.00
R7718:Prr35 UTSW 17 26,165,998 (GRCm39) nonsense probably null
R7841:Prr35 UTSW 17 26,167,458 (GRCm39) nonsense probably null
R8845:Prr35 UTSW 17 26,165,823 (GRCm39) missense probably benign 0.12
R9012:Prr35 UTSW 17 26,166,685 (GRCm39) missense probably benign
R9351:Prr35 UTSW 17 26,166,118 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCATACTGACACTGGACAGG -3'
(R):5'- ACCCTTGGACCTCTCAGTGAAG -3'

Sequencing Primer
(F):5'- TGGACAGGCCCAGACAACG -3'
(R):5'- ACCTCTCAGTGAAGCGGGTAC -3'
Posted On 2019-09-13