Incidental Mutation 'R7350:Cstf3'
ID570479
Institutional Source Beutler Lab
Gene Symbol Cstf3
Ensembl Gene ENSMUSG00000027176
Gene Namecleavage stimulation factor, 3' pre-RNA, subunit 3
Synonyms4732468G05Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R7350 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location104590523-104665429 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104608956 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 38 (L38P)
Ref Sequence ENSEMBL: ENSMUSP00000028599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028599]
PDB Structure
Crystal Structure of the HAT-C domain of murine CstF-77 [X-RAY DIFFRACTION]
Crystal structure of HAT domain of murine CstF-77 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028599
AA Change: L38P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028599
Gene: ENSMUSG00000027176
AA Change: L38P

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
HAT 45 77 4.67e-8 SMART
HAT 79 110 5.04e-4 SMART
HAT 117 152 1.38e-1 SMART
HAT 163 196 4.39e-4 SMART
HAT 229 261 1.19e0 SMART
HAT 271 303 9.12e0 SMART
HAT 319 352 2.73e0 SMART
HAT 354 387 7.31e-1 SMART
HAT 424 456 2.37e0 SMART
HAT 458 494 1.46e0 SMART
low complexity region 597 619 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of three (including CSTF1 and CSTF2) cleavage stimulation factors that combine to form the cleavage stimulation factor complex (CSTF). This complex is involved in the polyadenylation and 3' end cleavage of pre-mRNAs. The encoded protein functions as a homodimer and interacts directly with both CSTF1 and CSTF2 in the CSTF complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A T 17: 25,946,711 V534D probably damaging Het
Abraxas2 T C 7: 132,874,849 F106S probably damaging Het
Acsf3 A G 8: 122,785,946 T369A probably benign Het
Adgrf5 G A 17: 43,428,444 probably null Het
Aff1 T A 5: 103,847,092 I1052K probably benign Het
Akap8 T C 17: 32,316,575 D155G possibly damaging Het
Alg10b A T 15: 90,227,450 M166L probably benign Het
Allc T A 12: 28,563,409 Q178L possibly damaging Het
Angptl4 C A 17: 33,777,110 L297F probably damaging Het
Arfgap1 A G 2: 180,971,076 K8E possibly damaging Het
Bckdhb T A 9: 84,010,326 V270E possibly damaging Het
Cbx3 T C 6: 51,475,375 probably null Het
Cd44 G T 2: 102,834,262 N531K probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cr2 A G 1: 195,155,286 V792A probably benign Het
Cyp2a5 A G 7: 26,836,783 E151G probably benign Het
Dbr1 T C 9: 99,582,549 F127S Het
Ddit4 A T 10: 59,951,495 D6E probably damaging Het
Disc1 G C 8: 125,165,102 R631S probably damaging Het
Dnah5 T A 15: 28,235,819 probably null Het
Dnah9 T C 11: 66,080,578 K1595E probably damaging Het
Dnmbp T C 19: 43,901,505 R608G probably damaging Het
Efcab5 G C 11: 77,137,561 P315A probably benign Het
Eif4a2 A G 16: 23,113,262 Y392C possibly damaging Het
F5 G T 1: 164,192,708 K917N probably benign Het
Fig4 T C 10: 41,251,756 M571V probably benign Het
Flot2 T A 11: 78,057,976 I259N probably damaging Het
Gm8122 C A 14: 43,230,601 probably null Het
Gpr152 T C 19: 4,142,964 V168A possibly damaging Het
H1f0 G A 15: 79,028,903 G61D probably damaging Het
Ihh T A 1: 74,948,333 K183M probably damaging Het
Itga2 A G 13: 114,837,202 L1116P probably damaging Het
Kcnj10 A G 1: 172,369,260 T114A possibly damaging Het
Kcnk3 T G 5: 30,621,966 L120R probably damaging Het
Krt14 C A 11: 100,205,100 E211* probably null Het
Lars2 T C 9: 123,427,480 L350P probably damaging Het
Lrba T C 3: 86,351,902 I1408T probably damaging Het
Lrrc27 A G 7: 139,226,106 E229G probably benign Het
Lrrc8e G T 8: 4,235,626 R617L probably benign Het
M1ap A G 6: 82,981,949 D187G probably benign Het
March1 A T 8: 66,468,399 K243* probably null Het
Med16 C T 10: 79,903,197 V252M probably damaging Het
Micu3 T C 8: 40,348,958 S189P probably benign Het
Mier2 C A 10: 79,540,298 M264I unknown Het
Mindy4 A T 6: 55,301,025 N618I probably damaging Het
Mmrn1 C T 6: 60,976,336 Q534* probably null Het
Mroh9 C T 1: 163,076,289 probably null Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mta3 T A 17: 83,708,441 I24N probably damaging Het
Mtmr4 A T 11: 87,600,650 H147L probably damaging Het
Nfam1 T C 15: 83,010,439 K155R probably benign Het
Nlrp6 A T 7: 140,921,278 probably benign Het
Olfr1006 A G 2: 85,674,845 F102S Het
Olfr1153 T C 2: 87,896,409 probably benign Het
Olfr1164 A T 2: 88,093,198 F246Y probably benign Het
Olfr213 A G 6: 116,540,534 E27G probably benign Het
Olfr357 T A 2: 36,996,861 I17N possibly damaging Het
P4ha1 A G 10: 59,350,418 R240G probably damaging Het
Pla2r1 G T 2: 60,458,379 D636E probably benign Het
Polr2a A G 11: 69,741,060 L1060P possibly damaging Het
Ptgdr2 C A 19: 10,940,955 Q279K probably benign Het
Rab11fip2 T A 19: 59,937,421 R121S probably benign Het
Rasa2 T C 9: 96,544,355 S813G probably benign Het
Rassf5 T C 1: 131,178,536 K411E possibly damaging Het
Reep4 T C 14: 70,546,547 Y35H probably damaging Het
Ror1 A T 4: 100,425,943 M402L probably benign Het
Slc32a1 A G 2: 158,614,406 E327G probably damaging Het
Spen C T 4: 141,479,385 E644K unknown Het
Tarsl2 C G 7: 65,658,924 Q281E probably damaging Het
Tcl1 A G 12: 105,218,675 I92T probably damaging Het
Tifab A G 13: 56,176,307 S108P probably damaging Het
Traf1 T C 2: 34,948,233 N198D probably benign Het
Trim35 T C 14: 66,309,205 Y474H probably damaging Het
Trim54 T A 5: 31,137,161 D344E probably benign Het
Ttc28 A T 5: 111,226,037 H1113L probably damaging Het
Vcam1 T A 3: 116,114,562 D617V probably damaging Het
Vmn2r81 A T 10: 79,268,385 T281S probably benign Het
Whrn C T 4: 63,431,959 R507K possibly damaging Het
Zdhhc14 A G 17: 5,726,876 S303G probably benign Het
Zfp292 A T 4: 34,806,839 N2073K probably benign Het
Zgpat T A 2: 181,380,435 V163D Het
Other mutations in Cstf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01911:Cstf3 APN 2 104646631 missense probably damaging 1.00
IGL02734:Cstf3 APN 2 104609194 splice site probably benign
IGL03025:Cstf3 APN 2 104608931 missense possibly damaging 0.82
R0043:Cstf3 UTSW 2 104645085 splice site probably benign
R0189:Cstf3 UTSW 2 104652446 missense probably damaging 1.00
R0332:Cstf3 UTSW 2 104646467 critical splice donor site probably null
R0499:Cstf3 UTSW 2 104649605 missense possibly damaging 0.95
R1476:Cstf3 UTSW 2 104648219 missense possibly damaging 0.82
R1677:Cstf3 UTSW 2 104664278 intron probably benign
R1881:Cstf3 UTSW 2 104654218 missense probably benign
R1916:Cstf3 UTSW 2 104655756 missense possibly damaging 0.90
R3720:Cstf3 UTSW 2 104653086 splice site probably benign
R3813:Cstf3 UTSW 2 104609121 missense probably damaging 1.00
R5155:Cstf3 UTSW 2 104652485 missense probably benign
R5304:Cstf3 UTSW 2 104663390 nonsense probably null
R5564:Cstf3 UTSW 2 104609002 intron probably benign
R5869:Cstf3 UTSW 2 104659240 intron probably null
R6172:Cstf3 UTSW 2 104651642 missense probably damaging 1.00
R6747:Cstf3 UTSW 2 104646767 missense probably damaging 1.00
R6841:Cstf3 UTSW 2 104655731 missense probably benign 0.22
R6959:Cstf3 UTSW 2 104649462 missense probably benign
R7139:Cstf3 UTSW 2 104653064 missense possibly damaging 0.87
R7143:Cstf3 UTSW 2 104646616 missense probably benign 0.01
X0013:Cstf3 UTSW 2 104659277 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TGTTCATATAGTCCACGTAATGCC -3'
(R):5'- AACTGGGCAACAAGGCGTTC -3'

Sequencing Primer
(F):5'- TTCCAAAGGTCCGGAGTTCAGATC -3'
(R):5'- GCAACAAGGCGTTCGTAAGTCTTC -3'
Posted On2019-09-13