Incidental Mutation 'R7398:Mcidas'
ID573984
Institutional Source Beutler Lab
Gene Symbol Mcidas
Ensembl Gene ENSMUSG00000074651
Gene Namemulticiliate differentiation and DNA synthesis associated cell cycle protein
SynonymsIdas, Mci, multicilin, Mcin, Gm6320
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7398 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location112993845-113000394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112996882 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 116 (N116D)
Ref Sequence ENSEMBL: ENSMUSP00000089721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092089]
Predicted Effect probably benign
Transcript: ENSMUST00000092089
AA Change: N116D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000089721
Gene: ENSMUSG00000074651
AA Change: N116D

DomainStartEndE-ValueType
low complexity region 60 73 N/A INTRINSIC
Pfam:Geminin 169 258 4.8e-20 PFAM
low complexity region 262 272 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the geminin family of proteins. The encoded nuclear protein is required for the generation of multiciliated cells in respiratory epithelium. Mutations in this gene cause a rare mucociliary clearance disorder associated with recurring respiratory infections in human patients, known as reduced generation of multiple motile cilia (RGMC). [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T A 2: 31,790,799 S368T probably damaging Het
Acmsd A G 1: 127,729,435 probably benign Het
Arid3b A T 9: 57,796,212 S445T probably benign Het
Brinp1 A G 4: 68,841,354 V91A probably benign Het
Ccne1 A G 7: 38,106,277 probably null Het
Col3a1 A T 1: 45,327,813 I249F unknown Het
Crybg3 T C 16: 59,557,325 I1189V probably benign Het
Cyp2d34 A T 15: 82,616,763 D389E probably benign Het
D130043K22Rik A C 13: 24,893,377 I998L probably damaging Het
Dgkq A G 5: 108,655,190 I298T possibly damaging Het
Dnah17 T C 11: 118,080,724 E2161G probably damaging Het
Dnajc25 T C 4: 59,017,824 probably null Het
Dpp9 G A 17: 56,189,405 R768* probably null Het
Dusp27 A G 1: 166,100,475 S523P probably damaging Het
Dusp6 T A 10: 99,264,878 N245K probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eea1 C A 10: 95,995,631 H195N probably benign Het
Efhc1 A G 1: 20,989,520 E598G probably benign Het
Epb41l1 T C 2: 156,534,762 V809A probably damaging Het
Gas8 T A 8: 123,518,951 M1K probably null Het
Gcm1 G A 9: 78,064,679 V301I probably benign Het
Gm11554 T A 11: 99,804,259 S43C unknown Het
Gm7298 A G 6: 121,781,953 I1177V probably benign Het
Gm8011 A G 14: 42,463,961 T27A Het
Hmcn1 A G 1: 150,646,670 I3493T probably benign Het
Insrr T G 3: 87,808,732 I578S probably damaging Het
Kif13b A G 14: 64,757,523 D908G probably null Het
Lhcgr G C 17: 88,772,046 Q71E probably benign Het
Lrrc34 T C 3: 30,643,342 D80G probably damaging Het
Lrrc7 C A 3: 158,291,958 E156* probably null Het
Lrrc9 A G 12: 72,500,816 D1255G probably damaging Het
Mmp7 A G 9: 7,697,593 N210D probably damaging Het
Morc3 A G 16: 93,874,860 D926G probably damaging Het
Mrgpra9 A G 7: 47,235,637 I94T possibly damaging Het
Muc16 C A 9: 18,637,742 V5752F possibly damaging Het
Myo16 A T 8: 10,562,183 D1276V unknown Het
Nlrc4 T G 17: 74,446,542 E282A probably damaging Het
Nos2 T A 11: 78,936,471 Y227* probably null Het
Obox5 A C 7: 15,758,788 M223L probably benign Het
Olfr1337 C A 4: 118,781,699 L295F possibly damaging Het
Pygm G A 19: 6,385,936 R139H probably damaging Het
Ranbp2 C A 10: 58,467,277 P789T probably damaging Het
Riok2 T G 17: 17,387,239 S350A probably benign Het
Rnf214 C T 9: 45,867,547 V445I possibly damaging Het
Skida1 C T 2: 18,046,272 V603I unknown Het
Skint6 T A 4: 112,898,138 R747S probably benign Het
Slc24a5 G A 2: 125,085,774 W331* probably null Het
Slc5a10 A T 11: 61,673,579 C525S probably benign Het
Sult2b1 T C 7: 45,731,294 Y288C probably damaging Het
Tagln3 G T 16: 45,723,077 N67K probably damaging Het
Trav21-dv12 A T 14: 53,876,705 H94L probably benign Het
Tshz2 A G 2: 169,884,174 E230G probably damaging Het
Usb1 T A 8: 95,345,303 H210Q probably damaging Het
Vill C T 9: 119,070,648 P767L probably benign Het
Vmn2r94 A T 17: 18,257,341 N269K probably benign Het
Other mutations in Mcidas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Mcidas APN 13 112997585 splice site probably benign
IGL01355:Mcidas APN 13 112999069 missense probably damaging 1.00
IGL02000:Mcidas APN 13 112997440 missense probably benign
IGL02019:Mcidas APN 13 112996843 missense probably benign 0.00
R0145:Mcidas UTSW 13 112994372 missense probably damaging 1.00
R0412:Mcidas UTSW 13 112999143 missense probably damaging 1.00
R1293:Mcidas UTSW 13 112997392 missense probably benign
R2011:Mcidas UTSW 13 112993981 missense possibly damaging 0.84
R4183:Mcidas UTSW 13 112994372 missense probably damaging 1.00
R4905:Mcidas UTSW 13 112994417 missense possibly damaging 0.84
R4905:Mcidas UTSW 13 112997504 missense possibly damaging 0.82
R5615:Mcidas UTSW 13 112997425 missense probably benign 0.01
R5997:Mcidas UTSW 13 112998586 missense probably damaging 0.99
R6848:Mcidas UTSW 13 112993885 missense probably benign
R7387:Mcidas UTSW 13 112994088 missense probably benign 0.03
R7742:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7795:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7797:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7872:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7873:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7955:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7956:Mcidas UTSW 13 112998987 missense probably damaging 1.00
X0066:Mcidas UTSW 13 112997447 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGCAAGCCTACTGTTCTATGG -3'
(R):5'- AGGGTCTTTATTCCCAGAACCC -3'

Sequencing Primer
(F):5'- AAGCCTACTGTTCTATGGGTCAGAC -3'
(R):5'- TTTATTCCCAGAACCCACACTG -3'
Posted On2019-09-13