Incidental Mutation 'R7525:Whamm'
ID582920
Institutional Source Beutler Lab
Gene Symbol Whamm
Ensembl Gene ENSMUSG00000045795
Gene NameWAS protein homolog associated with actin, golgi membranes and microtubules
SynonymsWhdc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7525 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location81571266-81596836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 81593850 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 607 (G607C)
Ref Sequence ENSEMBL: ENSMUSP00000128881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165460] [ENSMUST00000207123] [ENSMUST00000209044]
Predicted Effect probably damaging
Transcript: ENSMUST00000165460
AA Change: G607C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128881
Gene: ENSMUSG00000045795
AA Change: G607C

DomainStartEndE-ValueType
Pfam:WHAMM-JMY_N 5 54 1.1e-30 PFAM
Pfam:JMY 67 435 1.3e-157 PFAM
coiled coil region 448 470 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 631 656 N/A INTRINSIC
WH2 698 716 5.69e2 SMART
WH2 728 745 6.26e-2 SMART
coiled coil region 758 785 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207123
Predicted Effect probably benign
Transcript: ENSMUST00000209044
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in actin nucleation, Golgi membrane association and microtubule binding. The encoded protein is a nucleation-promoting factor that regulates the Actin-related protein 2/3 complex. The activated complex initiates growth of new actin filaments by binding to existing actin filaments. The encoded protein also functions in regulation of transport from the endoplasmic reticulum to the Golgi complex and in maintenance of the Golgi complex near the centrosome. Four pseudogenes of this gene are present on the same arm of chromosome 15 as this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,183,355 T998A probably damaging Het
AI314180 A G 4: 58,847,038 I508T possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Akt3 T A 1: 177,020,107 K465* probably null Het
Ankar T C 1: 72,688,641 D371G probably benign Het
Ankib1 T G 5: 3,755,734 N178H possibly damaging Het
Arhgap10 A G 8: 77,420,070 probably null Het
Arhgef4 A G 1: 34,809,704 D286G probably damaging Het
Bsdc1 A T 4: 129,461,684 probably benign Het
Camk4 T C 18: 33,185,032 V414A probably benign Het
Cyp2d9 T A 15: 82,454,092 V139E possibly damaging Het
Dhrs13 C A 11: 78,032,434 N21K unknown Het
Dopey1 C T 9: 86,506,290 A439V probably damaging Het
Dpy19l4 G A 4: 11,317,160 Q13* probably null Het
Eif2ak1 T C 5: 143,886,898 S388P probably damaging Het
Emilin2 T C 17: 71,274,979 S251G probably benign Het
Eml4 T A 17: 83,445,950 L350Q probably damaging Het
Fblim1 A T 4: 141,590,080 L98H probably damaging Het
Fcrl6 T A 1: 172,597,672 N264I probably benign Het
Gm13124 A G 4: 144,565,010 F42S probably damaging Het
Gzme A C 14: 56,119,333 D57E probably benign Het
H2-D1 A G 17: 35,265,933 T257A probably damaging Het
Hectd4 C A 5: 121,343,665 D3092E possibly damaging Het
Hrc A G 7: 45,336,379 E318G probably benign Het
Hspbp1 A G 7: 4,663,436 L315P probably damaging Het
Insr A T 8: 3,192,642 Y591N probably damaging Het
Lrch4 T A 5: 137,639,465 I582N probably damaging Het
Lrit2 A G 14: 37,072,493 K505E possibly damaging Het
Lrp1b A T 2: 40,657,416 N4251K Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Mgam T G 6: 40,766,020 N1791K probably benign Het
Mroh7 A T 4: 106,709,702 I450N probably benign Het
Mylk G A 16: 34,988,987 M1771I probably benign Het
Olfr1335 A T 4: 118,809,494 F123L probably damaging Het
Olfr26 A T 9: 38,855,238 M59L possibly damaging Het
Olfr612 A T 7: 103,539,131 C34* probably null Het
Olfr972 T A 9: 39,874,139 L288* probably null Het
Parp14 A T 16: 35,857,491 H702Q probably benign Het
Pcdhga1 T C 18: 37,662,228 L95P probably damaging Het
Pcsk5 T C 19: 17,642,590 T373A probably damaging Het
Pdzph1 A G 17: 58,967,341 V836A possibly damaging Het
Pgap1 T A 1: 54,530,922 N322I probably benign Het
Pikfyve C T 1: 65,244,426 R741* probably null Het
Pip4k2c A G 10: 127,208,904 S80P probably damaging Het
Plekhh3 A G 11: 101,166,619 F271L probably damaging Het
Prkdc A T 16: 15,672,327 Y565F probably damaging Het
Prom2 T C 2: 127,532,781 R612G probably benign Het
Psap T C 10: 60,299,474 V303A probably benign Het
Ptch1 C T 13: 63,511,714 R1375H probably benign Het
Slc24a3 A C 2: 145,613,530 K446N probably benign Het
Slc39a12 T A 2: 14,494,461 M661K probably benign Het
Slc6a16 T C 7: 45,259,113 L39P probably benign Het
Syne1 T G 10: 5,185,559 probably null Het
Taar8c T C 10: 24,101,866 N16S probably benign Het
Tmem98 A G 11: 80,817,518 T105A probably damaging Het
Tmub1 T A 5: 24,446,013 Y216F probably damaging Het
Trim16 T G 11: 62,820,754 C84G probably damaging Het
Ttn T A 2: 76,731,229 K28978* probably null Het
Usp38 A G 8: 81,014,246 V64A probably damaging Het
Vmn2r63 A T 7: 42,926,982 F469Y possibly damaging Het
Vmn2r74 A G 7: 85,961,302 W61R probably benign Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp398 A G 6: 47,865,818 D268G probably benign Het
Other mutations in Whamm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Whamm APN 7 81578266 missense probably damaging 1.00
IGL01139:Whamm APN 7 81595914 missense probably damaging 1.00
IGL01870:Whamm APN 7 81595974 missense probably damaging 0.96
IGL03153:Whamm APN 7 81589532 splice site probably benign
R0179:Whamm UTSW 7 81594015 missense probably benign 0.00
R0364:Whamm UTSW 7 81594051 missense probably benign 0.00
R0550:Whamm UTSW 7 81586224 missense possibly damaging 0.55
R0682:Whamm UTSW 7 81586138 missense probably damaging 1.00
R1388:Whamm UTSW 7 81586290 missense probably damaging 1.00
R1940:Whamm UTSW 7 81578299 missense probably null 0.94
R1991:Whamm UTSW 7 81591771 nonsense probably null
R1992:Whamm UTSW 7 81591771 nonsense probably null
R2103:Whamm UTSW 7 81591771 nonsense probably null
R2104:Whamm UTSW 7 81591771 nonsense probably null
R2162:Whamm UTSW 7 81571341 missense probably damaging 1.00
R2291:Whamm UTSW 7 81591771 nonsense probably null
R3078:Whamm UTSW 7 81571784 missense probably damaging 1.00
R4735:Whamm UTSW 7 81571374 missense probably benign 0.01
R6336:Whamm UTSW 7 81591764 missense probably damaging 1.00
R6723:Whamm UTSW 7 81596120 missense probably damaging 1.00
R6747:Whamm UTSW 7 81578302 critical splice donor site probably null
R7029:Whamm UTSW 7 81591826 missense probably benign 0.09
R7286:Whamm UTSW 7 81586247 missense probably damaging 0.98
R7732:Whamm UTSW 7 81571424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGAAGTGCCCGGCTCATC -3'
(R):5'- GCCAAAGTCCTGAGCCCTAAATTC -3'

Sequencing Primer
(F):5'- TCGGTCTGCACTGAAAACAACTTG -3'
(R):5'- GTCCTGAGCCCTAAATTCTGATGAG -3'
Posted On2019-10-17