Incidental Mutation 'R7525:Arhgef4'
ID582889
Institutional Source Beutler Lab
Gene Symbol Arhgef4
Ensembl Gene ENSMUSG00000037509
Gene NameRho guanine nucleotide exchange factor (GEF) 4
Synonyms9330140K16Rik, Asef
MMRRC Submission
Accession Numbers

Genbank: NM_183019; MGI: 2442507; Ensembl: ENSMUSG00000070955

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7525 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location34678188-34813309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34809704 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 286 (D286G)
Ref Sequence ENSEMBL: ENSMUSP00000035980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047534] [ENSMUST00000047664] [ENSMUST00000159021] [ENSMUST00000159747] [ENSMUST00000160855] [ENSMUST00000162599] [ENSMUST00000167518]
Predicted Effect probably benign
Transcript: ENSMUST00000047534
SMART Domains Protein: ENSMUSP00000042212
Gene: ENSMUSG00000037503

DomainStartEndE-ValueType
Pfam:TCRP1 1 194 1e-108 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000047664
AA Change: D286G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035980
Gene: ENSMUSG00000037509
AA Change: D286G

DomainStartEndE-ValueType
SH3 1 45 6.97e-7 SMART
RhoGEF 82 261 3.86e-56 SMART
PH 294 402 2.33e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159021
SMART Domains Protein: ENSMUSP00000124467
Gene: ENSMUSG00000037509

DomainStartEndE-ValueType
SH3 1 45 6.97e-7 SMART
Pfam:RhoGEF 82 190 3.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159747
AA Change: D1657G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124213
Gene: ENSMUSG00000037509
AA Change: D1657G

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 686 712 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 1119 1137 N/A INTRINSIC
low complexity region 1240 1254 N/A INTRINSIC
SH3 1361 1416 3.73e-16 SMART
RhoGEF 1453 1632 3.86e-56 SMART
PH 1665 1773 2.33e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160855
SMART Domains Protein: ENSMUSP00000124207
Gene: ENSMUSG00000037509

DomainStartEndE-ValueType
SH3 1 45 6.97e-7 SMART
Pfam:RhoGEF 82 187 1.2e-21 PFAM
low complexity region 194 211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162599
AA Change: D430G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124906
Gene: ENSMUSG00000037509
AA Change: D430G

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
SH3 194 249 3.73e-16 SMART
Pfam:RhoGEF 304 405 1.2e-25 PFAM
PH 438 546 2.33e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167518
SMART Domains Protein: ENSMUSP00000131720
Gene: ENSMUSG00000037503

DomainStartEndE-ValueType
Pfam:TCRP1 1 62 3.3e-26 PFAM
Pfam:TCRP1 54 206 1.1e-89 PFAM
Meta Mutation Damage Score 0.3956 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The protein encoded by this gene may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased angiogenesis, vascular endothelial cell migration, tumor growth, and tumor vascularization. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,183,355 T998A probably damaging Het
AI314180 A G 4: 58,847,038 I508T possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Akt3 T A 1: 177,020,107 K465* probably null Het
Ankar T C 1: 72,688,641 D371G probably benign Het
Ankib1 T G 5: 3,755,734 N178H possibly damaging Het
Arhgap10 A G 8: 77,420,070 probably null Het
Bsdc1 A T 4: 129,461,684 probably benign Het
Camk4 T C 18: 33,185,032 V414A probably benign Het
Cyp2d9 T A 15: 82,454,092 V139E possibly damaging Het
Dhrs13 C A 11: 78,032,434 N21K unknown Het
Dopey1 C T 9: 86,506,290 A439V probably damaging Het
Dpy19l4 G A 4: 11,317,160 Q13* probably null Het
Eif2ak1 T C 5: 143,886,898 S388P probably damaging Het
Emilin2 T C 17: 71,274,979 S251G probably benign Het
Eml4 T A 17: 83,445,950 L350Q probably damaging Het
Fblim1 A T 4: 141,590,080 L98H probably damaging Het
Fcrl6 T A 1: 172,597,672 N264I probably benign Het
Gm13124 A G 4: 144,565,010 F42S probably damaging Het
Gzme A C 14: 56,119,333 D57E probably benign Het
H2-D1 A G 17: 35,265,933 T257A probably damaging Het
Hectd4 C A 5: 121,343,665 D3092E possibly damaging Het
Hrc A G 7: 45,336,379 E318G probably benign Het
Hspbp1 A G 7: 4,663,436 L315P probably damaging Het
Insr A T 8: 3,192,642 Y591N probably damaging Het
Lrch4 T A 5: 137,639,465 I582N probably damaging Het
Lrit2 A G 14: 37,072,493 K505E possibly damaging Het
Lrp1b A T 2: 40,657,416 N4251K Het
Mfsd13a T C 19: 46,369,277 F290S probably damaging Het
Mgam T G 6: 40,766,020 N1791K probably benign Het
Mroh7 A T 4: 106,709,702 I450N probably benign Het
Mylk G A 16: 34,988,987 M1771I probably benign Het
Olfr1335 A T 4: 118,809,494 F123L probably damaging Het
Olfr26 A T 9: 38,855,238 M59L possibly damaging Het
Olfr612 A T 7: 103,539,131 C34* probably null Het
Olfr972 T A 9: 39,874,139 L288* probably null Het
Parp14 A T 16: 35,857,491 H702Q probably benign Het
Pcdhga1 T C 18: 37,662,228 L95P probably damaging Het
Pcsk5 T C 19: 17,642,590 T373A probably damaging Het
Pdzph1 A G 17: 58,967,341 V836A possibly damaging Het
Pgap1 T A 1: 54,530,922 N322I probably benign Het
Pikfyve C T 1: 65,244,426 R741* probably null Het
Pip4k2c A G 10: 127,208,904 S80P probably damaging Het
Plekhh3 A G 11: 101,166,619 F271L probably damaging Het
Prkdc A T 16: 15,672,327 Y565F probably damaging Het
Prom2 T C 2: 127,532,781 R612G probably benign Het
Psap T C 10: 60,299,474 V303A probably benign Het
Ptch1 C T 13: 63,511,714 R1375H probably benign Het
Slc24a3 A C 2: 145,613,530 K446N probably benign Het
Slc39a12 T A 2: 14,494,461 M661K probably benign Het
Slc6a16 T C 7: 45,259,113 L39P probably benign Het
Syne1 T G 10: 5,185,559 probably null Het
Taar8c T C 10: 24,101,866 N16S probably benign Het
Tmem98 A G 11: 80,817,518 T105A probably damaging Het
Tmub1 T A 5: 24,446,013 Y216F probably damaging Het
Trim16 T G 11: 62,820,754 C84G probably damaging Het
Ttn T A 2: 76,731,229 K28978* probably null Het
Usp38 A G 8: 81,014,246 V64A probably damaging Het
Vmn2r63 A T 7: 42,926,982 F469Y possibly damaging Het
Vmn2r74 A G 7: 85,961,302 W61R probably benign Het
Whamm G T 7: 81,593,850 G607C probably damaging Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp398 A G 6: 47,865,818 D268G probably benign Het
Other mutations in Arhgef4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Arhgef4 APN 1 34811696 missense possibly damaging 0.88
IGL02376:Arhgef4 APN 1 34806059 missense probably damaging 1.00
IGL02604:Arhgef4 APN 1 34811723 nonsense probably null
IGL03240:Arhgef4 APN 1 34806026 missense probably benign 0.03
BB004:Arhgef4 UTSW 1 34807253 missense probably damaging 1.00
BB014:Arhgef4 UTSW 1 34807253 missense probably damaging 1.00
R0095:Arhgef4 UTSW 1 34732370 nonsense probably null
R0157:Arhgef4 UTSW 1 34806394 missense probably damaging 1.00
R0243:Arhgef4 UTSW 1 34806999 splice site probably null
R0383:Arhgef4 UTSW 1 34810533 missense probably damaging 1.00
R0440:Arhgef4 UTSW 1 34745448 splice site probably null
R0452:Arhgef4 UTSW 1 34732322 missense probably damaging 0.97
R0893:Arhgef4 UTSW 1 34807110 missense probably damaging 1.00
R1429:Arhgef4 UTSW 1 34810339 missense probably damaging 1.00
R1437:Arhgef4 UTSW 1 34723945 missense unknown
R1669:Arhgef4 UTSW 1 34732158 missense possibly damaging 0.86
R1780:Arhgef4 UTSW 1 34724160 missense possibly damaging 0.73
R1809:Arhgef4 UTSW 1 34810555 critical splice donor site probably null
R1879:Arhgef4 UTSW 1 34722440 missense unknown
R1908:Arhgef4 UTSW 1 34724259 missense probably benign 0.01
R1919:Arhgef4 UTSW 1 34811140 missense probably damaging 0.98
R2020:Arhgef4 UTSW 1 34723810 missense unknown
R2058:Arhgef4 UTSW 1 34722377 missense unknown
R2213:Arhgef4 UTSW 1 34807149 splice site probably null
R2851:Arhgef4 UTSW 1 34724048 missense unknown
R2852:Arhgef4 UTSW 1 34724048 missense unknown
R2853:Arhgef4 UTSW 1 34724048 missense unknown
R3697:Arhgef4 UTSW 1 34722440 missense unknown
R4012:Arhgef4 UTSW 1 34725106 missense possibly damaging 0.75
R4118:Arhgef4 UTSW 1 34732347 missense probably damaging 0.98
R4133:Arhgef4 UTSW 1 34806104 missense probably damaging 1.00
R4534:Arhgef4 UTSW 1 34723081 missense unknown
R4535:Arhgef4 UTSW 1 34723081 missense unknown
R4581:Arhgef4 UTSW 1 34732124 missense possibly damaging 0.83
R4665:Arhgef4 UTSW 1 34806032 missense possibly damaging 0.89
R4678:Arhgef4 UTSW 1 34722668 missense unknown
R4684:Arhgef4 UTSW 1 34811785 splice site probably null
R4706:Arhgef4 UTSW 1 34732217 missense probably benign 0.00
R4745:Arhgef4 UTSW 1 34807275 missense probably damaging 1.00
R4747:Arhgef4 UTSW 1 34723274 missense unknown
R4988:Arhgef4 UTSW 1 34723454 missense unknown
R5063:Arhgef4 UTSW 1 34724215 missense probably benign 0.00
R5154:Arhgef4 UTSW 1 34732374 missense probably benign 0.43
R5156:Arhgef4 UTSW 1 34723274 missense unknown
R5263:Arhgef4 UTSW 1 34724997 missense possibly damaging 0.84
R5450:Arhgef4 UTSW 1 34807324 intron probably benign
R5807:Arhgef4 UTSW 1 34807615 intron probably benign
R5863:Arhgef4 UTSW 1 34722845 missense unknown
R6034:Arhgef4 UTSW 1 34721903 missense unknown
R6034:Arhgef4 UTSW 1 34721903 missense unknown
R6311:Arhgef4 UTSW 1 34723981 missense unknown
R6315:Arhgef4 UTSW 1 34723477 missense unknown
R6316:Arhgef4 UTSW 1 34723477 missense unknown
R6318:Arhgef4 UTSW 1 34723477 missense unknown
R6323:Arhgef4 UTSW 1 34723477 missense unknown
R6324:Arhgef4 UTSW 1 34723477 missense unknown
R6325:Arhgef4 UTSW 1 34723477 missense unknown
R6340:Arhgef4 UTSW 1 34732223 missense probably damaging 1.00
R6835:Arhgef4 UTSW 1 34806493 missense probably damaging 1.00
R6981:Arhgef4 UTSW 1 34722452 missense unknown
R7087:Arhgef4 UTSW 1 34811686 missense probably damaging 0.96
R7297:Arhgef4 UTSW 1 34807192 missense probably damaging 1.00
R7614:Arhgef4 UTSW 1 34732235 missense possibly damaging 0.67
R7693:Arhgef4 UTSW 1 34724141 missense probably benign 0.01
R7892:Arhgef4 UTSW 1 34721804 missense unknown
R7895:Arhgef4 UTSW 1 34806397 missense probably damaging 1.00
R7927:Arhgef4 UTSW 1 34807253 missense probably damaging 1.00
R7965:Arhgef4 UTSW 1 34811681 missense probably benign
R7973:Arhgef4 UTSW 1 34724437 missense possibly damaging 0.83
R7979:Arhgef4 UTSW 1 34721897 missense unknown
R8160:Arhgef4 UTSW 1 34723574 missense unknown
R8175:Arhgef4 UTSW 1 34810374 missense probably benign
R8178:Arhgef4 UTSW 1 34722902 missense unknown
RF012:Arhgef4 UTSW 1 34724484 small deletion probably benign
X0062:Arhgef4 UTSW 1 34724227 missense probably benign 0.35
YA93:Arhgef4 UTSW 1 34732217 missense probably benign 0.00
Z1176:Arhgef4 UTSW 1 34723729 missense unknown
Z1176:Arhgef4 UTSW 1 34804926 missense probably damaging 1.00
Z1177:Arhgef4 UTSW 1 34722921 missense unknown
Z1177:Arhgef4 UTSW 1 34723366 missense unknown
Z1177:Arhgef4 UTSW 1 34724259 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTACTTCAGCGACCTCAGATC -3'
(R):5'- TACTCCATGAGACTGGTCTGG -3'

Sequencing Primer
(F):5'- CTATGACGACAGGGGTGGCTATG -3'
(R):5'- CCATGAGACTGGTCTGGCTAGG -3'
Posted On2019-10-17