Incidental Mutation 'R7638:Kbtbd13'
ID 590075
Institutional Source Beutler Lab
Gene Symbol Kbtbd13
Ensembl Gene ENSMUSG00000054978
Gene Name kelch repeat and BTB (POZ) domain containing 13
Synonyms
MMRRC Submission 045696-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.180) question?
Stock # R7638 (G1)
Quality Score 98.0078
Status Validated
Chromosome 9
Chromosomal Location 65388684-65391652 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 65391323 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 110 (C110*)
Ref Sequence ENSEMBL: ENSMUSP00000136872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068307]
AlphaFold Q8C828
Predicted Effect probably null
Transcript: ENSMUST00000068307
AA Change: C110*
SMART Domains Protein: ENSMUSP00000136872
Gene: ENSMUSG00000054978
AA Change: C110*

DomainStartEndE-ValueType
Blast:BTB 7 105 9e-57 BLAST
Kelch 210 258 4.33e-4 SMART
Kelch 259 305 2.39e-6 SMART
Blast:Kelch 307 351 5e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene belongs to a family of genes encoding proteins containing a BTB domain and several kelch repeats. The BTB domain functions as a protein-protein interaction module, which includes an ability to self-associate or to interact with non-BTB domain-containing proteins. The kelch motif typically occurs in groups of five to seven repeats, and has been found in proteins with diverse functions. Known functions of these family members include transcription regulation, ion channel tetramerization and gating, protein ubiquitination or degradation, and cytoskeleton regulation. The exact function of this family member has yet to be determined. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,320,917 V161A probably damaging Het
Abo T G 2: 26,843,843 T115P probably damaging Het
Aggf1 G A 13: 95,356,413 R563* probably null Het
Amdhd1 A T 10: 93,534,498 Y159* probably null Het
BC027072 T C 17: 71,750,885 D599G probably damaging Het
C77080 T C 4: 129,221,941 T1022A probably benign Het
Camp T C 9: 109,848,393 E124G Het
Casq2 A G 3: 102,086,700 E21G possibly damaging Het
Cbln1 A T 8: 87,471,729 F116Y probably damaging Het
Cklf A T 8: 104,263,364 K143* probably null Het
Clca3a1 A G 3: 144,751,962 I387T probably damaging Het
Cndp1 T A 18: 84,636,049 D130V probably benign Het
Cyp4a12a T A 4: 115,327,473 M317K possibly damaging Het
D13Ertd608e A T 13: 119,842,688 probably null Het
Dmxl2 A T 9: 54,457,794 I138K unknown Het
Eapp A G 12: 54,673,723 S236P probably benign Het
Efnb3 T C 11: 69,557,220 H132R possibly damaging Het
Fbn2 A T 18: 58,105,136 N596K probably damaging Het
Fzd9 A G 5: 135,250,630 W134R probably damaging Het
Gga2 A G 7: 122,003,934 S180P probably damaging Het
Gm11639 T A 11: 105,036,799 M4798K probably benign Het
Gm30302 G T 13: 49,786,975 Q420K probably benign Het
Golga3 A G 5: 110,205,828 T911A probably benign Het
Gstm1 C T 3: 108,014,550 probably null Het
Heg1 A G 16: 33,727,497 T909A probably damaging Het
Herc2 C T 7: 56,220,525 R4349W probably damaging Het
Herc2 T C 7: 56,157,438 S2455P probably benign Het
Hivep2 T G 10: 14,143,851 M2122R possibly damaging Het
Itga10 T A 3: 96,657,391 probably null Het
Krt78 T C 15: 101,950,883 E293G probably damaging Het
Lgals3bp C T 11: 118,398,169 V110M possibly damaging Het
Lrp2 A G 2: 69,477,008 probably null Het
Lrrc14 A G 15: 76,713,973 D301G probably benign Het
Lrrc71 C A 3: 87,741,806 G352W probably damaging Het
Map3k9 A G 12: 81,724,732 V694A probably benign Het
Mboat2 T C 12: 24,939,326 S162P probably damaging Het
Megf11 C A 9: 64,679,253 N422K probably damaging Het
Miga1 C T 3: 152,276,687 S584N probably benign Het
Mindy2 A G 9: 70,616,859 Y403H probably damaging Het
Mmd C T 11: 90,276,757 A204V possibly damaging Het
Mta3 A T 17: 83,800,143 Y262F probably benign Het
Ncoa7 G A 10: 30,722,798 S43F probably benign Het
Nphp4 T C 4: 152,554,534 V874A probably benign Het
Nsd1 A G 13: 55,312,328 T2226A probably benign Het
Nt5dc1 T C 10: 34,314,796 H302R probably benign Het
Odc1 A G 12: 17,550,002 Y389C probably damaging Het
Olfr175-ps1 G A 16: 58,824,595 T38I probably damaging Het
Olfr551 A G 7: 102,587,918 I275T probably damaging Het
Olfr970 T G 9: 39,819,893 F85V probably damaging Het
Pcdhb10 A C 18: 37,412,312 Q147P probably benign Het
Pdcl2 A C 5: 76,317,828 C182G probably damaging Het
Pigv T C 4: 133,665,451 D136G possibly damaging Het
Pramel5 T C 4: 144,271,440 E411G possibly damaging Het
Prkce T C 17: 86,168,600 V3A probably benign Het
Pth1r T C 9: 110,722,393 N546S probably benign Het
Qrich2 C T 11: 116,455,322 V1559I probably benign Het
Rbm20 A C 19: 53,814,333 D424A possibly damaging Het
Rbm26 C T 14: 105,150,848 D393N probably damaging Het
Sf3b3 G A 8: 110,820,813 R728C probably damaging Het
Srcap A G 7: 127,538,748 N1090S probably benign Het
Syt4 A T 18: 31,443,822 S160T probably benign Het
Tfap2e C T 4: 126,721,934 V236M probably damaging Het
Thsd4 G A 9: 60,394,472 T180M probably damaging Het
Tlr4 T A 4: 66,840,206 M412K probably damaging Het
Tmem67 T A 4: 12,079,883 H136L probably benign Het
Tnpo2 T A 8: 85,044,415 I110N probably benign Het
Trav13d-3 A G 14: 53,033,413 M111V probably benign Het
Tubb3 A T 8: 123,421,161 S278C probably benign Het
Ugcg T A 4: 59,220,299 F364Y probably benign Het
Usp17lc T C 7: 103,418,499 S334P probably damaging Het
Vps13c A G 9: 67,945,509 D2357G probably damaging Het
Zfp157 T C 5: 138,455,910 Y125H probably benign Het
Zfp747 A T 7: 127,374,647 M117K probably benign Het
Znrd1 A C 17: 36,957,830 probably null Het
Zscan4c A T 7: 11,009,731 N419I possibly damaging Het
Other mutations in Kbtbd13
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1594:Kbtbd13 UTSW 9 65391619 missense probably benign 0.00
R4774:Kbtbd13 UTSW 9 65390743 missense probably benign 0.18
R6392:Kbtbd13 UTSW 9 65390337 missense possibly damaging 0.94
R7556:Kbtbd13 UTSW 9 65391475 missense probably benign 0.00
R7874:Kbtbd13 UTSW 9 65390302 missense probably benign 0.04
R9260:Kbtbd13 UTSW 9 65391570 missense possibly damaging 0.58
X0061:Kbtbd13 UTSW 9 65390688 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CACGATGTAGAGCTTGTTGCCC -3'
(R):5'- TGGACGGTCAACTCTTCCAG -3'

Sequencing Primer
(F):5'- CTCGTCCAGGAAGCACATG -3'
(R):5'- TCAACTCTTCCAGGCGGAG -3'
Posted On 2019-10-24