Incidental Mutation 'R7645:Ltc4s'
List |< first << previous [record 22 of 48] next >> last >|
ID590490
Institutional Source Beutler Lab
Gene Symbol Ltc4s
Ensembl Gene ENSMUSG00000020377
Gene Nameleukotriene C4 synthase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.511) question?
Stock #R7645 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location50236461-50238616 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 50238546 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041725] [ENSMUST00000101265] [ENSMUST00000102772] [ENSMUST00000125555] [ENSMUST00000221525]
Predicted Effect probably benign
Transcript: ENSMUST00000041725
SMART Domains Protein: ENSMUSP00000043346
Gene: ENSMUSG00000036620

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Glyco_transf_54 98 387 6.6e-138 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101265
SMART Domains Protein: ENSMUSP00000098823
Gene: ENSMUSG00000020377

DomainStartEndE-ValueType
Pfam:MAPEG 8 112 4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102772
SMART Domains Protein: ENSMUSP00000099833
Gene: ENSMUSG00000020377

DomainStartEndE-ValueType
Pfam:MAPEG 8 131 1.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125555
SMART Domains Protein: ENSMUSP00000121584
Gene: ENSMUSG00000020377

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 64 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151803
SMART Domains Protein: ENSMUSP00000116802
Gene: ENSMUSG00000036620

DomainStartEndE-ValueType
Pfam:Glyco_transf_54 46 252 1.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221525
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: The protein encoded by this gene is an enzyme that catalyzes the synthesis of leukotriene C4 by combining leukotriene A4 with reduced glutathione. The encoded protein is found in the outer nuclear membrane and in the peripheral endoplasmic reticulum. Leukotrienes have been implicated as mediators of anaphylaxis and inflammatory conditions such as bronchial asthma in humans. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormal inflammatory and hypersensitivity reactions but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,256,255 C375S probably benign Het
Adgrg3 A G 8: 95,034,764 probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Atg2b T C 12: 105,623,430 Y1854C probably benign Het
Bcat2 T A 7: 45,587,963 N290K probably benign Het
Ccdc39 T C 3: 33,825,169 probably null Het
Cnot10 T C 9: 114,613,637 S501G probably benign Het
Col6a6 A G 9: 105,767,198 probably null Het
Coq2 A C 5: 100,660,250 C228W probably damaging Het
Cpt2 A T 4: 107,906,974 M531K possibly damaging Het
Dennd1a A G 2: 38,021,363 L204P probably damaging Het
Dirc2 T A 16: 35,734,068 probably null Het
Dock9 C T 14: 121,597,663 V1305M probably benign Het
Dusp16 A G 6: 134,725,925 I201T probably damaging Het
Esco2 T C 14: 65,827,181 D370G probably benign Het
Fbxl4 T C 4: 22,377,037 S158P probably damaging Het
Fut10 A G 8: 31,236,204 H329R possibly damaging Het
Gm10436 T C 12: 88,176,258 T392A probably damaging Het
Gpr3 A G 4: 133,211,329 W11R probably damaging Het
H2-M3 T A 17: 37,270,729 I94N probably damaging Het
Krt7 T C 15: 101,412,643 I57T probably damaging Het
Ms4a6b A T 19: 11,523,940 T105S probably damaging Het
Muc6 T C 7: 141,648,658 H592R probably benign Het
Ncam1 T C 9: 49,565,003 E262G probably benign Het
Olfr1265 T A 2: 90,037,747 I276K possibly damaging Het
Olfr1462 T C 19: 13,191,573 V302A probably benign Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Polg2 A T 11: 106,775,593 M242K probably benign Het
Polr3g T C 13: 81,694,444 T151A unknown Het
Psmb8 T C 17: 34,200,212 L160P possibly damaging Het
Rab5b G A 10: 128,681,391 A176V possibly damaging Het
Rreb1 T C 13: 37,931,034 C790R probably damaging Het
Rufy3 A G 5: 88,640,617 T506A probably benign Het
Samd11 T C 4: 156,255,183 probably benign Het
Slc12a2 T C 18: 57,896,378 F279L possibly damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Srgn C T 10: 62,494,978 W116* probably null Het
Svil A G 18: 5,099,663 E1733G probably damaging Het
Tbc1d22a C T 15: 86,235,541 P49S probably benign Het
Tbc1d9 A T 8: 83,242,553 K490M probably damaging Het
Tcte1 A G 17: 45,534,989 N173S probably benign Het
Tmco6 C T 18: 36,735,393 R31W probably damaging Het
Ttn C A 2: 76,899,681 A5155S unknown Het
Tyro3 T C 2: 119,816,906 Y839H probably damaging Het
Zc3h12d A G 10: 7,867,576 D370G probably benign Het
Zc3h7b T C 15: 81,780,602 L554P probably damaging Het
Zfp352 C T 4: 90,224,777 P385S probably benign Het
Other mutations in Ltc4s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03194:Ltc4s APN 11 50236571 makesense probably null
R0941:Ltc4s UTSW 11 50237442 critical splice acceptor site probably null
R1625:Ltc4s UTSW 11 50237388 missense possibly damaging 0.81
R2420:Ltc4s UTSW 11 50237339 critical splice donor site probably null
R4647:Ltc4s UTSW 11 50237225 missense probably benign 0.00
R4700:Ltc4s UTSW 11 50237081 missense probably damaging 1.00
R8367:Ltc4s UTSW 11 50236684 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGCTTGGACCTTGGTACCAG -3'
(R):5'- TGGGTGAGCAGCATGAGTTC -3'

Sequencing Primer
(F):5'- ACCTTGGTACCAGGAGGCTAG -3'
(R):5'- AGCATGAGTTCCGCCAC -3'
Posted On2019-10-24