Mutagenetix > Incidental Mutation

Incidental Mutation 'R7680:Ahi1'

592712

Institutional Source

Beutler Lab

Gene Symbol

Ahi1

Ensembl Gene

ENSMUSG00000019986

Gene Name

Abelson helper integration site 1

Synonyms

1700015F03Rik, Jouberin, D10Bwg0629e, Ahi-1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.880) question?

Stock #

R7680 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20952547-21080429 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 21007768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 844 (C844F)

Ref Sequence

ENSEMBL: ENSMUSP00000101164 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105525] [ENSMUST00000213104]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105525
AA Change: C844F

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000101164
Gene: ENSMUSG00000019986
AA Change: C844F

Domain	Start	End	E-Value	Type
low complexity region	50	67	N/A	INTRINSIC
low complexity region	85	106	N/A	INTRINSIC
low complexity region	148	159	N/A	INTRINSIC
WD40	448	490	4.3e-1	SMART
WD40	493	532	9.3e-9	SMART
WD40	537	576	2.48e-4	SMART
WD40	583	622	6.09e-4	SMART
WD40	641	678	1.9e2	SMART
WD40	684	721	3.98e0	SMART
WD40	724	769	9.51e1	SMART
SH3	905	961	2.15e-21	SMART
low complexity region	975	989	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213104
AA Change: C844F

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

Meta Mutation Damage Score

0.1117

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is apparently required for both cerebellar and cortical development in humans. This gene mutations cause specific forms of Joubert syndrome-related disorders. Joubert syndrome (JS) is a recessively inherited developmental brain disorder with several identified causative chromosomal loci. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mouse embryonic fibroblasts homozygous for one knock-out allele exhibit reduced and abnormal cilia. Mice homozygous for another knock-out allele exhibit premature death and abnormal kidney morphology and physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510002D24Rik	A	G	16: 18,839,208	D104G	possibly damaging	Het
AI464131	C	A	4: 41,497,978	D551Y	probably damaging	Het
B230118H07Rik	T	C	2: 101,610,556	E34G	probably damaging	Het
Bspry	T	C	4: 62,496,591	*474Q	probably null	Het
Car9	T	A	4: 43,507,250	D65E	probably damaging	Het
Ccdc110	T	A	8: 45,941,651	M193K	possibly damaging	Het
Ccdc166	A	G	15: 75,981,207	S304P	possibly damaging	Het
Cdcp1	T	C	9: 123,183,519	Q321R	probably damaging	Het
Cic	T	C	7: 25,292,431	V2255A	probably damaging	Het
Cmc2	A	T	8: 116,894,110	M44K	probably damaging	Het
Crls1	A	G	2: 132,862,338	T223A	probably damaging	Het
Ctnna3	A	T	10: 64,487,550	H488L	probably benign	Het
Cyp2r1	A	T	7: 114,552,819	I301N	probably damaging	Het
Dkk3	A	T	7: 112,119,363	L272Q	probably damaging	Het
Dnah14	A	G	1: 181,685,800	N1906S	probably benign	Het
Gm13271	T	C	4: 88,755,130	V88A	probably benign	Het
Gphn	C	A	12: 78,412,374	L79I	probably benign	Het
Gpr15	A	T	16: 58,717,965	W254R	probably damaging	Het
H2-M2	T	C	17: 37,483,025	R103G	possibly damaging	Het
Hcn4	T	C	9: 58,860,671	S1172P	probably benign	Het
Htr1a	A	G	13: 105,445,031	S260G	probably benign	Het
Kif21b	G	T	1: 136,147,869		probably null	Het
Lamp1	T	C	8: 13,167,812	Y131H	probably benign	Het
Lrrc47	A	C	4: 154,016,101	N378T	probably benign	Het
Manea	A	T	4: 26,340,649	H104Q	probably damaging	Het
Map4k3	A	G	17: 80,581,876	I888T	probably benign	Het
Mark3	T	C	12: 111,646,773	M557T	probably benign	Het
Muc6	G	C	7: 141,637,746	P2338R	probably damaging	Het
Myh6	C	A	14: 54,948,733	C1413F	possibly damaging	Het
Ncr1	T	A	7: 4,338,124	M38K	possibly damaging	Het
Nid2	A	G	14: 19,779,647	T669A	probably damaging	Het
Olfr49	T	A	14: 54,282,380	I172F	probably damaging	Het
Plat	G	T	8: 22,772,232	G91W	probably damaging	Het
Plekha7	A	G	7: 116,164,276	Y364H	probably benign	Het
Plxnb1	T	A	9: 109,100,503	Y142*	probably null	Het
Ptprn	T	C	1: 75,247,893	I940V	probably benign	Het
Rnf213	T	C	11: 119,479,556	V4728A		Het
Samd9l	A	T	6: 3,372,569	L1564Q	probably damaging	Het
Samd9l	A	G	6: 3,376,469	I264T	probably damaging	Het
Slc16a7	T	C	10: 125,230,936	D278G	probably benign	Het
Slc35f2	T	A	9: 53,808,112	V214E	probably damaging	Het
Slc7a5	A	C	8: 121,907,267	S114A	probably damaging	Het
St6galnac3	A	G	3: 153,205,410	S305P	probably damaging	Het
Stat1	G	A	1: 52,144,209	R378Q	probably damaging	Het
Tnfrsf9	T	G	4: 150,929,938	C31W	probably damaging	Het
Tnk1	T	C	11: 69,856,745	E61G	possibly damaging	Het
Tnks1bp1	T	A	2: 85,059,241	D637E	probably benign	Het
Ttc17	C	T	2: 94,366,544	G486D	probably benign	Het
Vmn1r30	T	A	6: 58,435,299	R183*	probably null	Het
Vmn2r78	A	G	7: 86,954,941	T776A	probably damaging	Het
Wrap73	A	G	4: 154,156,622	E444G	probably benign	Het
Zc3h13	C	T	14: 75,330,515	R1083C	probably damaging	Het
Zfp189	A	G	4: 49,521,547		probably benign	Het

Other mutations in Ahi1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ahi1	APN	10	20972141	missense	probably damaging	1.00
IGL00914:Ahi1	APN	10	20984299	splice site	probably null
IGL01075:Ahi1	APN	10	20987025	missense	possibly damaging	0.80
IGL01094:Ahi1	APN	10	20972060	missense	probably damaging	0.99
IGL01128:Ahi1	APN	10	21074433	missense	probably benign
IGL01527:Ahi1	APN	10	20960085	splice site	probably benign
IGL01821:Ahi1	APN	10	21041243	critical splice donor site	probably null
IGL02159:Ahi1	APN	10	21058177	missense	probably benign	0.13
IGL02176:Ahi1	APN	10	20970916	missense	probably benign	0.00
IGL02200:Ahi1	APN	10	20981314	splice site	probably benign
IGL02232:Ahi1	APN	10	20981375	missense	probably damaging	1.00
IGL02305:Ahi1	APN	10	20970897	missense	probably benign	0.00
IGL02323:Ahi1	APN	10	20972034	missense	probably damaging	1.00
IGL02885:Ahi1	APN	10	21055113	missense	possibly damaging	0.61
IGL02958:Ahi1	APN	10	20963799	missense	probably damaging	1.00
IGL02971:Ahi1	APN	10	21000551	missense	possibly damaging	0.93
IGL03109:Ahi1	APN	10	20970942	missense	probably benign	0.00
IGL03192:Ahi1	APN	10	20965635	missense	probably benign	0.00
IGL03377:Ahi1	APN	10	21018004	missense	possibly damaging	0.51
arisen	UTSW	10	21007768	missense	possibly damaging	0.53
urspringt	UTSW	10	20984393	missense	probably damaging	1.00
P4717OSA:Ahi1	UTSW	10	20972110	missense	probably damaging	1.00
P4748:Ahi1	UTSW	10	20972110	missense	probably damaging	1.00
R0448:Ahi1	UTSW	10	20972075	missense	probably damaging	1.00
R0559:Ahi1	UTSW	10	21000719	splice site	probably benign
R0627:Ahi1	UTSW	10	20965522	missense	probably benign	0.10
R0652:Ahi1	UTSW	10	20979461	missense	probably damaging	1.00
R0690:Ahi1	UTSW	10	20970843	splice site	probably benign
R1209:Ahi1	UTSW	10	20963730	missense	probably damaging	0.98
R1364:Ahi1	UTSW	10	20972156	missense	probably damaging	0.97
R1510:Ahi1	UTSW	10	20959800	missense	probably benign	0.00
R1634:Ahi1	UTSW	10	20965693	missense	probably damaging	1.00
R1789:Ahi1	UTSW	10	20963115	missense	probably benign	0.18
R1818:Ahi1	UTSW	10	20988562	missense	probably damaging	1.00
R2069:Ahi1	UTSW	10	20959996	missense	probably damaging	0.98
R2148:Ahi1	UTSW	10	20970976	missense	possibly damaging	0.64
R2566:Ahi1	UTSW	10	20970911	nonsense	probably null
R2850:Ahi1	UTSW	10	21000593	missense	probably benign	0.07
R2862:Ahi1	UTSW	10	20981408	missense	probably damaging	0.99
R3969:Ahi1	UTSW	10	20959947	missense	probably damaging	1.00
R4430:Ahi1	UTSW	10	20972078	missense	probably damaging	1.00
R4496:Ahi1	UTSW	10	20965545	missense	probably benign	0.07
R4755:Ahi1	UTSW	10	21055047	missense	possibly damaging	0.94
R4916:Ahi1	UTSW	10	20984404	missense	probably damaging	1.00
R5216:Ahi1	UTSW	10	20960076	missense	probably benign	0.00
R5223:Ahi1	UTSW	10	20970919	missense	possibly damaging	0.79
R5224:Ahi1	UTSW	10	20987022	missense	probably damaging	1.00
R5604:Ahi1	UTSW	10	20987005	missense	probably damaging	1.00
R5665:Ahi1	UTSW	10	21055047	missense	possibly damaging	0.94
R5704:Ahi1	UTSW	10	21074427	missense	probably benign
R5769:Ahi1	UTSW	10	20960082	critical splice donor site	probably null
R5899:Ahi1	UTSW	10	21000566	missense	probably benign	0.06
R5936:Ahi1	UTSW	10	20965933	missense	probably damaging	1.00
R5969:Ahi1	UTSW	10	20984393	missense	probably damaging	1.00
R6066:Ahi1	UTSW	10	20959926	missense	possibly damaging	0.84
R6122:Ahi1	UTSW	10	21058165	missense	probably benign	0.26
R6135:Ahi1	UTSW	10	20969121	missense	probably benign	0.01
R6240:Ahi1	UTSW	10	20977081	missense	probably damaging	1.00
R6387:Ahi1	UTSW	10	20969043	missense	probably damaging	1.00
R6395:Ahi1	UTSW	10	20979592	missense	possibly damaging	0.49
R6406:Ahi1	UTSW	10	20977049	missense	probably damaging	1.00
R6440:Ahi1	UTSW	10	20960082	critical splice donor site	probably benign
R6558:Ahi1	UTSW	10	20963673	missense	probably damaging	1.00
R6744:Ahi1	UTSW	10	20965567	missense	probably damaging	1.00
R6755:Ahi1	UTSW	10	21017913	missense	probably damaging	0.98
R6927:Ahi1	UTSW	10	21055069	missense	probably damaging	1.00
R6932:Ahi1	UTSW	10	20963691	missense	probably benign	0.02
R6967:Ahi1	UTSW	10	20988625	missense	probably damaging	0.98
R7168:Ahi1	UTSW	10	21017932	missense	probably benign	0.01
R7169:Ahi1	UTSW	10	21055019	missense	probably damaging	1.00
R7327:Ahi1	UTSW	10	20987077	missense	probably damaging	0.99
R7351:Ahi1	UTSW	10	20965933	missense	probably damaging	1.00
R7489:Ahi1	UTSW	10	20963750	missense	probably benign	0.35
R7878:Ahi1	UTSW	10	20981431	critical splice donor site	probably null
R7999:Ahi1	UTSW	10	20965681	missense	probably benign	0.31
R8219:Ahi1	UTSW	10	21074436	missense	probably benign	0.00
R8248:Ahi1	UTSW	10	20972092	missense	probably benign	0.04
R8560:Ahi1	UTSW	10	20959915	missense	probably benign	0.04
R8926:Ahi1	UTSW	10	21055083	missense	probably damaging	1.00
R8965:Ahi1	UTSW	10	20963862	missense	probably benign
R8987:Ahi1	UTSW	10	20963784	missense	probably damaging	1.00
R9013:Ahi1	UTSW	10	21007759	missense	probably benign	0.28
R9145:Ahi1	UTSW	10	21000589	missense	probably benign	0.01
R9365:Ahi1	UTSW	10	20972136	missense	probably damaging	0.99
R9567:Ahi1	UTSW	10	20981401	missense	possibly damaging	0.95
X0024:Ahi1	UTSW	10	21000592	missense	possibly damaging	0.69
Z1177:Ahi1	UTSW	10	21041007	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAGTGGAAACGATGCAGAC -3'
(R):5'- GGACCTGCACTGAAATTACATCC -3'

Sequencing Primer
(F):5'- TGGAAACGATGCAGACTGACAATTC -3'
(R):5'- ATTACATCCCAGTTGCTAGGAC -3'

Posted On

2019-11-12