Mutagenetix > Incidental Mutations

Incidental Mutation 'R7727:Trpm2'

595569

Institutional Source

Beutler Lab

Gene Symbol

Trpm2

Ensembl Gene

ENSMUSG00000009292

Gene Name

transient receptor potential cation channel, subfamily M, member 2

Synonyms

LTRPC2, 9830168K16Rik, TRPC7, Trrp7

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R7727 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77907722-77970563 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 77925789 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1009 (D1009G)

Ref Sequence

ENSEMBL: ENSMUSP00000101040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105401]

AlphaFold

Q91YD4

Predicted Effect

probably benign
Transcript: ENSMUST00000105401
AA Change: D1009G

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: D1009G

Domain	Start	End	E-Value	Type
low complexity region	654	672	N/A	INTRINSIC
transmembrane domain	750	772	N/A	INTRINSIC
Pfam:Ion_trans	794	1057	3.7e-21	PFAM
low complexity region	1078	1090	N/A	INTRINSIC
low complexity region	1106	1115	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC
PDB:1QVJ\|A	1236	1506	3e-37	PDB
SCOP:d1k2ea_	1369	1502	9e-10	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	C	A	6: 41,033,193	R69L	probably benign	Het
Adamts5	A	T	16: 85,899,966	L101Q	probably damaging	Het
Arhgap18	A	T	10: 26,870,011	I293F	possibly damaging	Het
Atp8b1	T	A	18: 64,545,275	Q850L	probably damaging	Het
B4galnt3	A	T	6: 120,225,187	F118Y	probably benign	Het
Bcl6	A	G	16: 23,971,413		probably null	Het
Cc2d2b	T	A	19: 40,756,530	L31Q	probably benign	Het
Cd5l	G	T	3: 87,367,855	E234*	probably null	Het
Cfap65	T	C	1: 74,926,625	T409A	probably benign	Het
Chst5	A	T	8: 111,890,925	I21N	probably benign	Het
Cldn20	T	C	17: 3,532,755	Y68H	probably benign	Het
Col4a4	T	C	1: 82,528,793	M269V	unknown	Het
Dgkh	A	G	14: 78,595,145		probably null	Het
Dpp6	A	G	5: 27,451,244	T166A	probably benign	Het
Drosha	A	G	15: 12,881,645	D754G	probably damaging	Het
Epb41l4a	C	A	18: 33,854,273	K350N	probably damaging	Het
Fsd1	T	G	17: 55,988,150	D46E	probably benign	Het
Gabra1	T	C	11: 42,133,591	D419G	probably damaging	Het
Golga4	T	A	9: 118,548,702	D458E	probably damaging	Het
Grm6	C	A	11: 50,851,542	A134E	probably benign	Het
Ikzf1	T	A	11: 11,748,339	S63R	probably damaging	Het
Ilvbl	G	A	10: 78,576,666	V74I	probably benign	Het
Kcng2	C	T	18: 80,296,090	V328M	probably benign	Het
Kpna7	T	C	5: 145,005,045	E145G	probably benign	Het
Krt81	A	G	15: 101,459,567	V428A	probably damaging	Het
Lalba	T	C	15: 98,482,668	M2V	probably benign	Het
Lrpprc	T	C	17: 84,776,947	S113G	probably benign	Het
Mboat1	A	C	13: 30,226,306	M249L	probably benign	Het
Meltf	T	C	16: 31,883,794	V113A	probably damaging	Het
Muc16	T	A	9: 18,660,242	H327L	unknown	Het
Myh1	A	G	11: 67,215,922	I1277V	probably benign	Het
Naf1	GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC	GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC	8: 66,860,548		probably benign	Het
Naga	C	A	15: 82,330,147	V388L	probably benign	Het
Nfkb1	A	C	3: 135,585,401	M957R	possibly damaging	Het
Nol12	C	A	15: 78,940,593	S157*	probably null	Het
Olfr1000	A	G	2: 85,608,407	F168L	possibly damaging	Het
Olfr1038-ps	A	T	2: 86,122,496	D191V	possibly damaging	Het
Olfr272	A	G	4: 52,911,368	V142A	possibly damaging	Het
Pcdhga5	T	C	18: 37,695,045	V182A	probably benign	Het
Pik3r4	A	G	9: 105,669,882	E953G	probably damaging	Het
Piwil2	C	T	14: 70,394,057	R646Q	probably damaging	Het
Plxnc1	T	C	10: 94,944,109	H157R	probably damaging	Het
Prrg4	A	T	2: 104,839,378	F131L	probably benign	Het
Rab28	A	G	5: 41,707,970	S4P	probably damaging	Het
Ranbp2	C	A	10: 58,455,438	Q209K	probably benign	Het
Schip1	G	A	3: 68,064,984	D15N	probably benign	Het
Serpina3f	T	G	12: 104,218,218	M207R	probably benign	Het
Sgsm1	A	T	5: 113,274,327	M487K	possibly damaging	Het
Sh3tc2	A	T	18: 61,989,580	I471F	probably benign	Het
Slamf1	G	A	1: 171,774,899	V65I	possibly damaging	Het
Slit3	T	C	11: 35,684,044	C1062R	probably damaging	Het
Snapc4	T	G	2: 26,373,434	K344N	probably damaging	Het
Sorl1	A	G	9: 41,984,526	Y1778H	probably damaging	Het
Spon2	G	A	5: 33,215,675	R228C	probably damaging	Het
Sv2c	A	G	13: 95,976,695	I582T	possibly damaging	Het
Tamm41	C	T	6: 115,016,178	V205M	probably damaging	Het
Tmem2	C	T	19: 21,829,957	L917F	probably benign	Het
Trpm6	T	C	19: 18,854,249	S1493P	probably damaging	Het
Ttc34	G	A	4: 154,839,274	V147I	possibly damaging	Het
Uba2	C	T	7: 34,150,850	A393T	probably damaging	Het
Ubn2	T	A	6: 38,463,938	N416K	probably benign	Het
Uevld	T	C	7: 46,943,805	N233S	probably benign	Het
Upp2	G	A	2: 58,774,148	M142I	possibly damaging	Het
Vps52	T	A	17: 33,962,134	V450D	probably benign	Het
Wdr31	A	T	4: 62,460,636	F118Y	probably damaging	Het
Zcchc6	A	G	13: 59,799,682	F942L	probably benign	Het
Zfp110	T	A	7: 12,848,995	D523E	possibly damaging	Het
Zfp367	A	T	13: 64,145,643	V143D	probably damaging	Het
Zfp950	T	C	19: 61,119,941	I235V	probably benign	Het

Other mutations in Trpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00730:Trpm2	APN	10	77942915	splice site	probably null
IGL00773:Trpm2	APN	10	77949214	nonsense	probably null
IGL00962:Trpm2	APN	10	77943916	splice site	probably benign
IGL01093:Trpm2	APN	10	77932280	missense	probably benign	0.04
IGL01124:Trpm2	APN	10	77945825	splice site	probably benign
IGL01301:Trpm2	APN	10	77923984	missense	probably damaging	1.00
IGL02094:Trpm2	APN	10	77942996	nonsense	probably null
IGL02175:Trpm2	APN	10	77937907	missense	probably benign	0.07
IGL02653:Trpm2	APN	10	77912669	missense	probably benign	0.19
IGL02667:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02668:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02828:Trpm2	APN	10	77918986	missense	probably benign	0.16
IGL02951:Trpm2	APN	10	77929278	missense	possibly damaging	0.95
IGL03188:Trpm2	APN	10	77918909	missense	probably benign	0.18
IGL03242:Trpm2	APN	10	77917734	missense	probably benign
IGL03405:Trpm2	APN	10	77966072	splice site	probably benign
Fugit	UTSW	10	77938368	missense	probably damaging	1.00
scusate	UTSW	10	77966994	nonsense	probably null
temporal	UTSW	10	77925682	missense	probably benign	0.30
ANU18:Trpm2	UTSW	10	77923984	missense	probably damaging	1.00
R0147:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0148:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0302:Trpm2	UTSW	10	77943990	splice site	probably benign
R0332:Trpm2	UTSW	10	77947988	missense	probably damaging	1.00
R0586:Trpm2	UTSW	10	77923516	missense	probably damaging	0.99
R0847:Trpm2	UTSW	10	77929288	missense	possibly damaging	0.94
R1183:Trpm2	UTSW	10	77923564	missense	probably damaging	1.00
R1472:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R1510:Trpm2	UTSW	10	77966994	nonsense	probably null
R1518:Trpm2	UTSW	10	77943005	missense	possibly damaging	0.67
R1564:Trpm2	UTSW	10	77942999	missense	probably benign	0.14
R1593:Trpm2	UTSW	10	77943076	missense	possibly damaging	0.71
R1617:Trpm2	UTSW	10	77935875	splice site	probably null
R1673:Trpm2	UTSW	10	77942944	missense	probably benign
R1912:Trpm2	UTSW	10	77945876	missense	probably benign	0.10
R1932:Trpm2	UTSW	10	77941158	missense	probably damaging	1.00
R1993:Trpm2	UTSW	10	77947989	missense	probably damaging	1.00
R2013:Trpm2	UTSW	10	77925766	missense	probably damaging	1.00
R2151:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R2201:Trpm2	UTSW	10	77920471	nonsense	probably null
R2217:Trpm2	UTSW	10	77941182	missense	probably damaging	1.00
R2312:Trpm2	UTSW	10	77918964	missense	probably benign	0.04
R2339:Trpm2	UTSW	10	77914806	splice site	probably benign
R2395:Trpm2	UTSW	10	77947880	missense	possibly damaging	0.69
R2396:Trpm2	UTSW	10	77930637	missense	probably benign	0.14
R2405:Trpm2	UTSW	10	77934724	missense	probably damaging	1.00
R2567:Trpm2	UTSW	10	77941174	missense	probably damaging	0.99
R3001:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3002:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3125:Trpm2	UTSW	10	77911374	missense	probably damaging	1.00
R3500:Trpm2	UTSW	10	77932302	missense	probably benign	0.03
R3777:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R3778:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R4272:Trpm2	UTSW	10	77933642	missense	probably damaging	1.00
R4384:Trpm2	UTSW	10	77917725	missense	probably benign	0.44
R4395:Trpm2	UTSW	10	77929219	missense	probably benign	0.01
R4423:Trpm2	UTSW	10	77935068	missense	probably benign	0.00
R4452:Trpm2	UTSW	10	77923593	missense	probably damaging	1.00
R4612:Trpm2	UTSW	10	77945916	missense	probably damaging	0.99
R4662:Trpm2	UTSW	10	77938138	missense	probably benign	0.05
R4825:Trpm2	UTSW	10	77941173	missense	probably damaging	0.98
R4906:Trpm2	UTSW	10	77932189	nonsense	probably null
R4943:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R4948:Trpm2	UTSW	10	77917792	missense	probably benign	0.34
R5046:Trpm2	UTSW	10	77966018	missense	probably damaging	1.00
R5320:Trpm2	UTSW	10	77923521	missense	probably benign	0.06
R5523:Trpm2	UTSW	10	77935961	missense	probably benign	0.04
R5562:Trpm2	UTSW	10	77959939	missense	possibly damaging	0.71
R5623:Trpm2	UTSW	10	77932139	missense	probably damaging	0.96
R5628:Trpm2	UTSW	10	77912636	missense	probably benign	0.00
R5633:Trpm2	UTSW	10	77938353	missense	possibly damaging	0.71
R5817:Trpm2	UTSW	10	77965980	missense	probably damaging	1.00
R5989:Trpm2	UTSW	10	77959900	missense	probably damaging	1.00
R6018:Trpm2	UTSW	10	77917713	missense	probably benign	0.00
R6075:Trpm2	UTSW	10	77935043	critical splice donor site	probably null
R6092:Trpm2	UTSW	10	77925682	missense	probably benign	0.30
R6309:Trpm2	UTSW	10	77938368	missense	probably damaging	1.00
R6327:Trpm2	UTSW	10	77932227	missense	probably damaging	1.00
R6568:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6579:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6640:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6642:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6798:Trpm2	UTSW	10	77914740	missense	probably damaging	0.99
R6999:Trpm2	UTSW	10	77935891	missense	probably damaging	1.00
R7034:Trpm2	UTSW	10	77912592	missense	probably benign
R7036:Trpm2	UTSW	10	77912592	missense	probably benign
R7113:Trpm2	UTSW	10	77947931	missense	probably damaging	0.96
R7171:Trpm2	UTSW	10	77924014	missense	probably damaging	1.00
R7240:Trpm2	UTSW	10	77935876	critical splice donor site	probably null
R7274:Trpm2	UTSW	10	77923555	missense	probably benign	0.00
R7379:Trpm2	UTSW	10	77914734	missense	probably benign
R7527:Trpm2	UTSW	10	77966060	missense	probably benign	0.01
R7571:Trpm2	UTSW	10	77937950	missense	probably benign	0.21
R7600:Trpm2	UTSW	10	77938051	missense	probably benign	0.02
R7771:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R7844:Trpm2	UTSW	10	77923506	missense	probably benign	0.00
R8158:Trpm2	UTSW	10	77947897	missense	probably damaging	0.99
R8225:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8226:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8239:Trpm2	UTSW	10	77936002	missense	probably benign	0.06
R8275:Trpm2	UTSW	10	77966025	nonsense	probably null
R8340:Trpm2	UTSW	10	77923624	nonsense	probably null
R8354:Trpm2	UTSW	10	77933649	missense	probably damaging	1.00
R8427:Trpm2	UTSW	10	77911402	missense	possibly damaging	0.93
R8445:Trpm2	UTSW	10	77910252	missense	probably damaging	1.00
R8769:Trpm2	UTSW	10	77932294	missense	probably benign	0.00
R9144:Trpm2	UTSW	10	77929288	missense	probably benign	0.01
R9286:Trpm2	UTSW	10	77941180	missense	probably benign	0.06
R9319:Trpm2	UTSW	10	77942942	nonsense	probably null
R9319:Trpm2	UTSW	10	77949198	missense	probably damaging	1.00
R9381:Trpm2	UTSW	10	77911357	missense	possibly damaging	0.90
Z1177:Trpm2	UTSW	10	77937868	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TGCCTGTGTACACACCAGTC -3'
(R):5'- TGGACCCTACCTAGTCAGAC -3'

Sequencing Primer
(F):5'- TGTGTACACACCAGTCCAGGAG -3'
(R):5'- CTAACTCCTGGGATGCAAGTGTC -3'

Posted On

2019-11-12