Incidental Mutation 'R7745:Hnrnph1'
ID596807
Institutional Source Beutler Lab
Gene Symbol Hnrnph1
Ensembl Gene ENSMUSG00000007850
Gene Nameheterogeneous nuclear ribonucleoprotein H1
SynonymsE430005G16Rik, Hnrph1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7745 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location50376990-50386528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50379497 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 43 (I43F)
Ref Sequence ENSEMBL: ENSMUSP00000076989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069304] [ENSMUST00000077817] [ENSMUST00000109142]
Predicted Effect probably damaging
Transcript: ENSMUST00000069304
AA Change: I43F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000070503
Gene: ENSMUSG00000007850
AA Change: I43F

DomainStartEndE-ValueType
RRM 12 86 3.77e-10 SMART
RRM 112 184 2.59e-8 SMART
low complexity region 236 254 N/A INTRINSIC
RRM 290 360 1.45e-11 SMART
low complexity region 383 401 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077817
AA Change: I43F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076989
Gene: ENSMUSG00000007850
AA Change: I43F

DomainStartEndE-ValueType
RRM 12 86 3.77e-10 SMART
RRM 112 184 2.59e-8 SMART
low complexity region 236 254 N/A INTRINSIC
RRM 290 360 1.45e-11 SMART
low complexity region 383 401 N/A INTRINSIC
low complexity region 413 437 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109142
AA Change: I43F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104770
Gene: ENSMUSG00000007850
AA Change: I43F

DomainStartEndE-ValueType
RRM 12 86 3.77e-10 SMART
RRM 112 184 2.59e-8 SMART
low complexity region 236 254 N/A INTRINSIC
RRM 290 360 1.45e-11 SMART
low complexity region 383 401 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins that complex with heterogeneous nuclear RNA. These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some may shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNA and is very similar to the family member HNRPF. This gene may be associated with hereditary lymphedema type I. Alternatively spliced transcript variants have been described [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 60,038,472 S188R probably damaging Het
Aars T A 8: 111,041,657 I220N probably damaging Het
Abca15 A G 7: 120,332,217 N16S probably damaging Het
Adck1 A T 12: 88,456,800 M358L probably benign Het
Adck5 A T 15: 76,594,548 Q345L probably benign Het
Adgrl2 A G 3: 148,836,458 F876S probably damaging Het
Aebp2 T A 6: 140,623,858 L55Q unknown Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Aox3 T C 1: 58,176,517 V1036A possibly damaging Het
Aox4 A G 1: 58,240,707 D494G probably benign Het
Cacna1a C A 8: 84,559,394 H889Q probably benign Het
Cacna1c T C 6: 119,052,626 D151G Het
Car8 A G 4: 8,237,939 V92A possibly damaging Het
Ccdc8 G T 7: 16,995,689 A368S unknown Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cntnap5a A G 1: 116,442,283 I877V probably benign Het
Copa A T 1: 172,111,942 D582V probably damaging Het
Cpne2 T G 8: 94,568,684 S466A probably damaging Het
Crybg2 A G 4: 134,088,845 K1311R possibly damaging Het
Csmd1 A G 8: 15,932,461 probably null Het
Dnah2 A T 11: 69,451,318 C2947* probably null Het
Exoc1 A T 5: 76,561,512 K656* probably null Het
Exoc8 T C 8: 124,895,819 N603S probably benign Het
Fam171a1 T A 2: 3,225,446 C539S possibly damaging Het
Fastkd5 A T 2: 130,615,068 I534K probably damaging Het
Fbn1 T C 2: 125,303,195 D2708G probably benign Het
Fhad1 A G 4: 141,890,939 L1392P probably benign Het
Fras1 A T 5: 96,726,895 T2306S probably benign Het
Gdf7 G T 12: 8,301,854 A27E unknown Het
Igkv8-27 T A 6: 70,172,015 S52C probably benign Het
Jmjd1c T C 10: 67,217,045 F24L probably damaging Het
Knl1 T G 2: 119,071,556 L1246R probably benign Het
Limk2 C T 11: 3,355,896 S191N probably damaging Het
Mdga2 G A 12: 66,689,350 A368V probably damaging Het
Mdga2 C A 12: 66,689,351 A368S possibly damaging Het
Med24 A T 11: 98,704,967 L966Q probably damaging Het
Mgll T C 6: 88,725,788 V23A possibly damaging Het
Nedd1 C T 10: 92,714,172 D84N probably benign Het
Obscn A C 11: 59,060,855 L4024R probably damaging Het
Olfr172 A T 16: 58,760,419 Y252* probably null Het
Pcnx2 T C 8: 125,851,107 I944V probably benign Het
Pecr T C 1: 72,266,998 probably null Het
Phf3 A T 1: 30,804,224 W1885R probably damaging Het
Pitpnm2 C G 5: 124,128,705 A697P probably benign Het
Piwil2 T A 14: 70,394,189 H602L probably benign Het
Pprc1 T C 19: 46,065,342 S1104P unknown Het
Prkar1a T A 11: 109,653,847 Y21* probably null Het
Prl2c3 A T 13: 12,798,297 Y9* probably null Het
Rhbdl3 T A 11: 80,323,579 L172Q possibly damaging Het
Rsph3a T G 17: 7,979,243 L484W probably damaging Het
Sbno1 A T 5: 124,392,899 S809T probably benign Het
Stmnd1 T A 13: 46,299,601 V251E possibly damaging Het
Stt3a A T 9: 36,751,239 C241* probably null Het
Tas2r114 A T 6: 131,689,438 M209K probably damaging Het
Tchh G T 3: 93,444,777 R508L unknown Het
Tgfbr3l T C 8: 4,250,622 S267P possibly damaging Het
Ttn T A 2: 76,767,800 I19590F probably damaging Het
Vmn1r171 A G 7: 23,632,610 T87A probably benign Het
Other mutations in Hnrnph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0480:Hnrnph1 UTSW 11 50385762 splice site probably benign
R2172:Hnrnph1 UTSW 11 50382816 missense probably benign 0.11
R3150:Hnrnph1 UTSW 11 50385792 missense probably benign
R4908:Hnrnph1 UTSW 11 50378410 missense probably damaging 0.97
R5661:Hnrnph1 UTSW 11 50384680 missense probably benign
R6194:Hnrnph1 UTSW 11 50383277 missense possibly damaging 0.89
R7501:Hnrnph1 UTSW 11 50379556 missense probably benign 0.00
R7650:Hnrnph1 UTSW 11 50383899 missense probably benign
R8172:Hnrnph1 UTSW 11 50379905 missense probably damaging 0.99
X0021:Hnrnph1 UTSW 11 50379479 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCATTGAGTTACCTTGTTGGACTAG -3'
(R):5'- CATTTCCATGCGGTCAAATACC -3'

Sequencing Primer
(F):5'- ACCTTGTTGGACTAGGAATATATCC -3'
(R):5'- GGGTAAGACCTCTATGTGTTTAAACG -3'
Posted On2019-11-26